Vibrio cholerae

I. Organism Information

A. Taxonomy Information
  1. Species:
    1. Vibrio cholerae :
      1. Ontology: UMLS:xxx
      2. GenBank Taxonomy No.: 666
      3. Description: Vibrio cholerae, a noninvasive gram-negative bacterium and the causative agent of the diarrheal disease cholera, is serologically classified as belonging to the O antigenic group. Strains belonging to O group 1 (O1) are responsible for cholera. Strains other than O1 are called non-O1; they can cause only sporadic infections and do not have the potential to cause epidemics. Strains of serovar O1 consist of two biotypes, classical and El Tor. Only recently, an outbreak of cholera in India and Bangladesh which subsequently spread into several parts of the subcontinent was caused by a novel non-O1 strain, O139 Bengal. However, several pieces of evidence suggested that strain O139 Bengal closely resembles biotype El Tor of the serovar O1 (Chatterjee et al., 1998). Vibrio cholerae as a species includes both pathogenic and nonpathogenic strains that vary in their virulence gene content. This bacterium contains a wide variety of strains and biotypes, receiving and transferring genes for toxins, colonization factors, antibiotic resistance, capsular polysaccharides that provide resistance to chlorine and new surface antigens, such as the 0139 lipopolysaccharide and O antigen capsule. The lateral or horizontal transfer of these virulence genes by phage, pathogenicity islands and other accessory genetic elements provides insights into how bacterial pathogens emerge and evolve to become new strains (Heidelberg et al., 2000).
      4. Variant(s):
        • Vibrio cholerae 1587; Vibrio cholerae strain 1587; Vibrio cholerae str. 1587 :
          • GenBank Taxonomy No.: 412966
          • Parent: Vibrio cholerae
          • Description: Vibrio cholerae 1587 is a clinical isolate from Peru. This strain is an O12 serotype and does not have genes for the cholera toxin or the toxin-coregulated pilus, two important virulence factors in Vibrio cholerae (NCBI Genome Project).
        • Vibrio cholerae 2740-80; Vibrio cholerae strain 2740-80; Vibrio cholerae str. 2740-80 :
        • Vibrio cholerae 569B :
          • GenBank Taxonomy No.: 44104
          • Parent: Vibrio cholerae
          • Description: Vibrio cholerae 569B is a hypertoxinogenic strain of Vibrio cholerae that was first isolated from a patient in 1948 in India (Bik et al., 1996).
        • Vibrio cholerae strain 623-39 :
          • GenBank Taxonomy No.: 417397
          • Parent: Vibrio cholerae
          • Description: The genome of Vibrio cholerae 623-39 is being sequenced at The Institute for Genomic Research (TIGR). Genome sequencing status: draft assembly; Project ID: 18493 (NCBI Genome Project).
        • Vibrio cholerae AM-19226; Vibrio cholerae strain AM-19226; Vibrio cholerae str. AM-19226 :
          • GenBank Taxonomy No.: 404974
          • Parent: Vibrio cholerae
          • Description: Vibrio cholerae AM-19226 is a clinical isolate from Bangladesh. This strain is an O39 serotype and does not have genes for the cholera toxin or the toxin-coregulated pilus, two important virulence factors in Vibrio cholerae (NCBI Genome Project).
        • Vibrio cholerae B33; Vibrio cholerae strain B33; Vibrio cholerae str. B33 :
          • GenBank Taxonomy No.: 404974
          • Parent: Vibrio cholerae
          • Description: Vibrio cholerae B33 was isolated from Beira, Mozambique in 2004. This strain is a hybrid between the classical and El Tor biotypes of Vibrio cholerae O1 (NCBI Genome Project).
        • Vibrio cholerae bv. albensis; Vibrio cholerae biovar albensis :
          • GenBank Taxonomy No.: 376726
          • Parent: Vibrio cholerae
          • Description: A luminescent bacterial species originally isolated from the Elbe River in 1893 with biochemical properties similar to those of V. cholerae was described by Shewan and Veron in 1974 as Vibrio cholerae biovar albensis. Desmarchelier and Reichelt and Reichelt et al. found > 80% DNA complementarity between V. cholerae biovar classical ATCC 14035 and V. cholerae biovar albensis ATCC 14547, indicating a high degree of genetic relatedness (Palmer and Colwell, 1991).
        • Vibrio cholerae MO10; Vibrio cholerae strain MO10; Vibrio cholerae str. MO10 :
          • GenBank Taxonomy No.: 345072
          • Parent: Vibrio cholerae
          • Description: Vibrio cholerae MO10 is a member of the O139 serogroup and was isolated during the cholera outbreak in India and Bangladesh in 1992 (NCBI Genome Project).
        • Vibrio cholerae MZO-2; Vibrio cholerae strain MZO-2; Vibrio cholerae str. MZO-2 :
          • GenBank Taxonomy No.: 417398
          • Parent: Vibrio cholerae
          • Description: Vibrio cholerae MZO-2 was isolated from patients with diarrhea in Bangladesh in 2001. This strain is an O14 serotype and does not have genes for the cholera toxin or the toxin-coregulated pilus, two important virulence factors in Vibrio cholerae (NCBI Genome Project).
        • Vibrio cholerae MZO-3; Vibrio cholerae strain MZO-3; Vibrio cholerae str. MZO-3 :
          • GenBank Taxonomy No.: 412883
          • Parent: Vibrio cholerae
          • Description: Vibrio cholerae MZO-3 is clinical isolate from Bangladesh. This strain is an O37 serotype and does not have genes for the cholera toxin or the toxin-coregulated pilus, two important virulence factors in Vibrio cholerae (NCBI NCBI Genome Project).
        • Vibrio cholerae NCTC 8457; Vibrio cholerae strain NCTC 8457; Vibrio cholerae str. NCTC 8457 :
          • GenBank Taxonomy No.: 417399
          • Parent: Vibrio cholerae
          • Description: Vibrio cholerae NCTC 8457 was isolated from a clinical specimen in Saudi Arabia in 1910. This strain is an O1 El Tor serotype which did not become pandemic and will be used for comparative analysis with other Vibrio cholerae strains (NCBI Genome Project).
        • VIbrio cholerae non-O1 :
          • GenBank Taxonomy No.: 66861
          • Parent: Vibrio cholerae
          • Description: Vibrio cholerae non-O1 strains are a heterogeneous group, comprising > 130 serotypes, and are generally isolated only from sporadic cases of cholera, indicating that they do not have the potential to cause epidemics. It was unprecedented, therefore that the recent cholera epidemic, which started in 1992 in Madras and soon spread to other parts of Asia is due to a non-O1 strain (Bik et al., 1995). V. cholerae non-O1 serogroups have been reported to be involved in the emergence of a newer variant of V. cholerae; this hypothesis is supported by the genesis of V. cholerae O139, a serogroup believed to have evolved by horizontal gene transfer from serogroup O1 to a non-O1 serogroup (Singh et al., 2001).
        • Vibrio cholerae non-O1/non-O139 :
          • GenBank Taxonomy No.: 156539
          • Parent: Vibrio cholerae
          • Description: The non-O1, non-O139 serogroups of V. cholerae comprise a heterogeneous group of organisms whose clinical association with humans is inadequately understood. Clinically, apart from the O1 and O139 serogroups, the non-O1, non-O139 serogroups continue to be of negligible significance since these strains are associated with illness in only a low percentage of patients hospitalized due to acute secretory diarrhea. Nucleotide analysis of the asd genes of 45 strains of V. cholerae has yielded provocative evidence which indicates that the classical and El Tor biotypes and U.S. Gulf Coast strains of V. cholerae O1 evolved independently from environmental nontoxigenic, non-O1 strains. Therefore, it has become increasingly clear that the non-O1, non-O139 serogroups are involved in the emergence of newer variants of V. cholerae, a fact supported by the genesis of V. cholerae O139, which is believed to have evolved as a result of horizontal gene transfer between the O1 and the non-O1 serogroups (Sharma et al., 1998).
        • Vibrio cholerae O1 :
          • GenBank Taxonomy No.: 127906
          • Parent: Vibrio cholerae non-O1/non-O139
          • Description: The sixth pandemic and presumably the fifth were caused by V. cholerae O1 of the classical biotype (Pazzani et al., 2006). The Matlab variants of Vibrio cholerae O1, defined as hybrids between the classical and El Tor biotypes, were first isolated from hospitalized patients with acute secretory diarrhoea in Matlab, a rural area of Bangladesh. These variants could not be categorized as classical or El Tor biotypes by phenotypic and genotypic tests, and had representative traits of both the biotypes (Safa et al., 2006). V. cholerae O1 and O139 are currently believed to be the only serogroups causing epidemic cholera, characterized by severe watery diarrhoea. V. cholerae O1 is further classified into two biotypes, classical and El Tor, and into two major serotypes, Inaba and Ogawa. V. cholerae O1 strains may exhibit serotype conversion or switching between Inaba and Ogawa serotypes. Extensive analysis of epidemic O1 strains that caused cholera outbreaks in Latin America in 1991 revealed that the El Tor Inaba strains were unique to Latin America. However, Ogawa isolates that were identical to epidemic strains in all respects began to appear in approximately month 7 of the epidemic, suggesting that the epidemic strains had undergone serotype conversion, possibly because of immune pressure in the population. In 1992, V. cholerae O139 serogroup replaced the Inaba serotype of V. cholerae O1 in Kolkata and other parts of India, and the last predominance of Inaba was observed in 1989. Isolation of V. cholerae O1 belonging to Inaba became rare, but isolations were reported from Warangal, Delhi and Sewagram. Extensive characterization of these Inaba isolates indicated that they were remarkably different from the earlier Inaba strains, but were very similar to the prevailing V. cholerae O1 Ogawa strains. In 2000, V. cholerae O1 Ogawa strains caused cholera outbreaks in the Kottayam district, and subsequently spread to the Alleppey and Trivandrum districts of Kerala, India (Mohapatra et al., 2007).
        • Vibrio cholerae O1 biovar eltor; Vibrio eltor; Vibrio cholerae biovar El tor; Vibrio cholerae biovar eltor :
          • GenBank Taxonomy No.: 686
          • Parent: Vibrio cholerae O1
          • Description: V. cholerae O1 biotype El Tor was first reported in 1905 (Alam et al., 2006). The biotype El Tor of vibrio cholerae O1 was isolated for the first time in Egypt at the beginning of the century and was associated with sporadic cases until 1961 (Seas and Gotuzzo, 2005). However, it was not until the early 1960s that V. cholerae biotype El Tor displaced the sixth-pandemic V. cholerae O1 classical biotype (Alam et al., 2006). Vibrio cholerae O1 ogawa (Eltor) strain is reported to be the predominant cause of cholera in India (Batra et al., 2006). The ongoing seventh pandemic, the most extensive in distribution and duration, began in 1961 and was caused by V. cholerae O1 of the El Tor biotype (Pazzani et al., 2006). In May 1996, a large outbreak of cholera caused by V. cholerae O1 El Tor Ogawa occurred in the Alleppey district of Kerala, India, and subsequently spread to the neighbouring Palghat district (Mohapatra et al., 2007).
        • Vibrio cholerae O139; Vibrio cholerae serogroup O139; misnomer: Vibrio cholerae O139 strain :
          • GenBank Taxonomy No.: 45888
          • Parent: Vibrio cholerae
          • Description: The emergence in 1992 of a V. cholerae non-O1 serovar, designated V. cholerae synonym O139 Bengal, in Bangladesh and India and its subsequent appearance in Southeast Asia, displacing V. cholerae O1 El Tor, was considered a significant point in the history of cholera (Alam et al., 2006). In the Autumn of 1993, V. cholerae serogroup O139 (Bengal), was implicated in outbreaks of cholera in Bangladesh and India. V. cholerae serogroup O139 (Bengal), causes characteristic severe cholera symptoms and has been implicated in a case of a traveller returning from India to the US (CWG et al., 1993). Bik and co-workers suggested that the O139 strain arose by horizontal gene transfer between a non-O1 and an O1 strain (Bik et al., 1996).
        • Vibrio cholerae O27; Vibrio cholerae serogroup O27 :
          • GenBank Taxonomy No.: 185331
          • Parent: Vibrio cholerae
          • Description: Vibrio cholerae serogroup O27 was isolated in Japan in 1996 from a prawn, imported from Thailand. The O27 strain appears to have been derived from an El Tor progenitor and to have acquired a distinct CTX(phi) and distinct vibrio pathogenicity island (VPI). It is also probable that O27 emerged from an El Tor strain by O-antigen switching and subsequently changed its rstR and tcpA genes by allelic exchange (Li et al., 2002).
        • Vibrio cholerae O37; Vibrio cholerae serogroup O37 :
          • GenBank Taxonomy No.: 185332
          • Parent: Vibrio cholerae
          • Description: The 037 strain was responsible for a large cholera outbreak in Sudan in 1968 and was classified as a noncholera vibrio. The study of Bik and co-workers, however, shows that the 037 Sudan strain is genetically closely related to classical O1 strains. Similar to 0139 Bengal, 037 Sudan lacked most of the O1 antigen cluster but did contain flanking genes. Thus, 037 Sudan represents a second example of an epidemic V. cholerae strain carrying non-O1 antigens (Bik et al., 1996).
        • Vibrio cholerae O395; Vibrio cholerae strain O395; Vibrio cholerae str. O395 :
          • GenBank Taxonomy No.: 345073
          • Parent: Vibrio cholerae
          • Description: The strain O395 is an isolate from a patient in India (Purdy et al., 2005). Vibrio cholerae O395 is a classical O1 serotype strain of the Ogawa biotype. This strain has been used extensively for molecular analysis of virulence factors (NCBI Genome Project).
        • Vibrio cholerae RC385; Vibrio cholerae strain RC385; Vibrio cholerae str. RC385 :
        • Vibrio cholerae V51; Vibrio cholerae strain V51; Vibrio cholerae str. V51 :
        • Vibrio cholerae V52; Vibrio cholerae strain V52; Vibrio cholerae str. V52 :
B. Lifecycle Information :
  1. >V. cholerae :
    1. Size: Overall, the cells are I micrometer in width and 2 to 3 micro meter in length and motile by at least one polar flagellum (Thompson and Swings, 2006).
    2. Shape: Members of the genus Vibrio are short, curved, rod-shaped organisms (Strohl et al., 2001). Vibrios display a wide variation in colony morphology (round to irregular) and color(beige to red) on tryptic soy agar. Colony variation is also a common feature of vibrios (Thompson and Swings, 2006).
    3. Picture(s):
      1. Electron Micrograph of Vibrio cholerae


      2. Electron Micrograph of Vibrio cholerae



        Description: Vibrio cholerae is a gram-negative, facultatively anaerobic, curved (vibrio-shaped), rod prokaryote that causes the disease cholera. Dennis Kunkel Microscopy, Inc. Used with permission
      3. The Vibrio cholerae bacterium



        Description: The Vibrio cholerae bacterium under an electron microscope. Color has been added to show the nucleic acid (orange) and the flagellum (tail), which is used by the bacterium to move. (Copyright: CNRI/Science Photo Library, Photo Researchers, Inc.)
      4. Vibrio cholerae



        Description: A transmission electron micrograph of Vibrio cholerae, negatively stained to enhance contrast. (Copyright: Wadsworth Center, New York State Department of Health). Cholera is characterized by watery, mucus-flecked stools commonly referred to as "rice water stool". Fluid and electrolyte loss in cholera can be severe. V. cholerae thrive in marine environments in temperate or tropical areas of the world. Infection is generally acquired through ingestion of contaminated food or water
    4. Other:
      1. The general assumption, until quite recently, was that cholera was spread only by infected people to other susceptible individuals via fecal contamination of water and food and that global movement of populations accounted for the global movement of the disease. Recent studies of the aquatic environment, however, have shown that V cholerae, including strains of O1 and O139, are normal inhabitants of surface water, particularly brackish waters, and survive and multiply in association with zooplankton and phytoplankton quite independently of infected human beings. Because global climate changes affect the growth of plankton, growth of the vibrios associated with plankton could also be modified. The continuing presence of cholera in the Indian subcontinent and the re-emergence of cholera in other continents may be highly dependent on environmental factors. The movement of the bacteria in association with plankton has led to the suggestion that ship ballast may be a cause of its global spread (Sack et al., 2004).
    5. Description: The life cycle of V. cholerae consists of two distinct phases. Outside of the host and in the aquatic phase, V. cholerae can be found as free swimming cells, attached to surfaces provided by plants, filamentous green algae, copepods, crustaceans, insects, and egg masses of chironomids (Sack et al., 2004). The most intriguing and least understood feature of Vibrio cholerae O1, however, comes from the study of its annual epidemic profile in the Bengal region of Bangladesh and India. There, nearly all cases each year occur in a synchronized, massive outbreak in the months of October and November, just as the monsoon rains decline. During most other months of the year, cholera cases occur sporadically or not at all. This epidemic profile and its correlation with major transitions of climate point to the following: V. cholerae O1 resides in a stable environmental reservoir; then, seasonally determined changes in rainfall and sunlight trigger its periodic and transient emergence as a human pathogen. Between epidemics, V. cholerae O1 lives in natural aquatic habitats formed by the confluence of the Ganges and the Brahmaputra rivers. All the physiochemical and ecological features of this system are dramatically influenced by the monsoon climate. Within this ecosystem, five distinctive stages have been proposed to comprise the V. cholerae environmental life cycle: an independent, free-swimming form; a symbiont of phytoplankton; a commensal of zooplankton; a viable, but not culturable state; and a biofilm community attached to abiotic or chitinous surfaces. Thus the functional repertoire of the V. cholerae O1 genome must be unusually broad as it accommodates two, quite distinctive, lifestyles: the milieu of the human intestine and long term residence in aquatic habitats that are subject to climate-determined changes of the microenvironment (Schoolnik and Yildiz, 2000). Biofilm formation and entry into a viable but non-culturable state in response to nutrient deprivation are thought to be important in facilitating environmental persistence within natural aquatic habitats during periods between epidemics. Neither the genetic events that help the organism to lead a life in association with plankton nor the biofilm ecology of vibrios on abiotic surfaces are completely understood. Although V. cholerae is part of the normal estuarine flora, toxigenic strains are mostly isolated from the environment in areas probably contaminated by infected individuals. Environmental isolates from areas that are distant from regions of infection do not generally have the cholera toxin genes. There are two crucial sequential steps in the evolution of a pathogenic V. cholerae. First, strains have to acquire the VPI (which most environmental strains do not have); second, having acquired the CTXphi receptor, the TCP-positive strains are infected with and lysogenised by CTXphi. Experiments in animals have shown that the intestinal milieu is the site where strains can acquire these mobile elements efficiently. Thus, V cholerae can be visualized as an autochthonous marine bacterium that colonizes and thrives in the human gut during phases of infection and spends the time between epidemics in its "original" habitat, the estuary (Sack et al., 2004). The functional annotation of the V. cholerae O1 sequence sheds light on this remarkable capacity. In particular, the distribution of genes of known function between the large and small chromosomes of the organism provides tantalizing clues about how the two-chromosome configuration of the Vibrionaceae might confer an evolutionary advantage in habitats that vary with climate change. Although the large chromosome (chrI) contains most of the genes that are required for growth and pathogenicity, some of the components of several essential metabolic and regulatory pathways reside on the small chromosome (chrII). Thus, retention of chrII is presumably required for survival of the organism, at least under some conditions of growth. By contrast, a larger percentage of hypothetical genes and genes of unknown function reside on chrII. This asymmetrical distribution of genes suggests that under certain conditions differences in the copy number of chrI and chrII might occur, potentially increasing the effective level of expression of genes on the more numerous chromosome to the organism's advantage. A related hypothesis, predicts that chrI genes mainly adapt the organism for growth in the intestine whereas chrII genes are essential within environmental niches. The organism's capacity to access nutrients within diverse environmental habitats is also enhanced by the extensive duplication of genes involved in nutrient scavenging. A striking example of this is the apparent duplication of genes coding for chitinase, which together with the corresponding phosphoenolpyruvate phosphotransferase system, produce and transport chitin-derived disaccharides released from the exoskeletons of zooplankton to which V. cholerae attach (Schoolnik and Yildiz, 2000).
C. Genome Summary:
  1. Genome of Vibrio cholerae O1 biovar eltor str. N16961; Vibrio cholerae serotype O1 biotype El Tor strain N16961; Vibrio cholerae el tor N16961
    1. Description: Vibrio cholerae O1 biovar eltor str. N16961 chromosome, complete sequence (NCBI Entrez). The complete genomic sequence of the Gram negative, gamma-Proteobacterium Vibrio cholerae El Tor N16961 was determined to be 4,033,460 base pairs (bp). The genome consists of two circular chromosomes of 2,961,146 (chromosome 1) and 1,072,314 (chromosome 2) base pairs, with an average G+C content of 46.9% and 47.7%, respectively. There are a total of 3,885 predicted open reading frames (ORFs) and 792 predicted Rho-independent terminators; with 2,770 and 1,115 ORFs and 599 and 193 Rho-independent terminators on the individual chromosomes (Heidelberg et al., 2000).
    2. Chromosome I:
      1. GenBank Accession Number: NC_002505
      2. Size: 2,961,149 nt (NCBI Entrez)
      3. Gene Count:
      4. Description: The vast majority of recognizable genes for essential cell functions (such as DNA replication, transcription, translation, and cell-wall biosynthesis) and pathogenicity (for example, toxins, surface antigens and adhesins) are located on the large chromosome (Heidelberg et al., 2000). Most genes required for growth and viability are located on chromosome 1. The replicative origin in chromosome 1 was identified by similarity to the Vibrio harveyi and Escherichia coli origins, co-localization of genes (dnaA, dnaN, recF and gyrA) often found near the origin in prokaryotic genomes, and GC nucleotide skew (G-C/ G+C) analysis. Based on these, we designated base-pair 1 in an intergenic region that is located in the putative origin of replication (Heidelberg et al., 2000).
    3. Chromosome II:
      1. GenBank Accession Number: NC_002506
      2. Size: 1,072,315 nt (NCBI Entrez)
      3. Gene Count:
      4. Description: The small chromosome contains a larger fraction (59%) of hypothetical genes compared with the large chromosome (42%), and also contains many more genes that appear to have origins other than the gamma-Proteobacteria. The small chromosome also carries a gene capture system (the integron island) and host 'addiction' genes that are typically found on plasmids; thus, the small chromosome may have originally been a megaplasmid that was captured by an ancestral Vibrio species. Some genes found only on chromosome 2 are also thought to be essential for normal cell function (for example, dsdA, thrS and the genes encoding ribosomal proteins L20 and L35). Additionally, many intermediaries of metabolic pathways are encoded only on chromosome 2 (Heidelberg et al., 2000). The V. cholerae integron island contains all copies of the V. cholerae repeat (VCR) sequence and 216 ORFs. However, most of these ORFs have no homology to other sequences. Among the recognizable integron island genes are three that encode gene products that may be involved in drug resistance (chloramphenicol acetyltransferase, fosfomycin resistance protein and glutathione transferase), several DNA metabolism enzymes (MutT, transposase, and an integrase), potential virulence genes (haemagglutinin and lipoproteins) and three genes which encode gene products similar to the `host addiction' proteins (higA, higB and doc), which are used by plasmids to select for their maintenance by host cells (Heidelberg et al., 2000).

  2. Genome of Vibrio cholerae
    1. Description: Vibrio cholerae plasmid pSIO1, complete sequence (NCBI Entrez)
    2. pSIO1:
      1. GenBank Accession Number: NC_006860
      2. Size: 4,906 nt (NCBI Entrez)
      3. Gene Count: 3 (NCBI Entrez)
      4. Description: High-copy plasmid preparations from Vibrio cholerae strain SIO resulted in the isolation of a 4.9-kbp element which was designated pSIO1. The complete nucleotide sequence of pSIO1 was obtained, revealing three open reading frames of approximately 300, 900, and 1,800 bp in length. Intriguingly, ORF2 and ORF3 were similar to genes involved in DNA transfer, and there is a region very similar to a sequence present in plasmids from V. shiloi and another environmental V. cholerae isolate (Purdy et al., 2005).

  3. Genome of Vibrio cholerae
    1. Description: Vibrio cholerae plasmid pTLC, complete sequence (NCBI Entrez)
    2. pTLC:
      1. GenBank Accession Number: NC_004982
      2. Size: 4,719 nt (NCBI Entrez)
      3. Gene Count: 5 (NCBI Entrez)
      4. Description: This 4.7 kb plasmid is an extrachromosomal circular double-stranded DNA form of a tandemly duplicated chromosomal element. Rubin and co-workers have named the cryptic plasmid pTLC for toxin-linked cryptic because it is adjacent to the CTX prophage on the V. cholerae chromosome. The size and low copy number of pTLC suggest that it is identical to the three megadalton plasmid identified by Cook et al. in many classical V. cholerae strains and the 'small cryptic plasmid' identified by Bartowsky and Manning in classical strain V58. The largest open reading frame in the plasmid is predicted to encode a protein similar to the replication initiation protein (pII) of Escherichia coli F-specific filamentous phages. The nucleotide sequence of pTLC also facilitated the structural characterization of the DNA homologous to pTLC in other strains of V. cholerae. pTLC-related DNA exists in these strains as both low-copy-number, covalently closed circular DNA and tandemly duplicated, chromosomally integrated DNA. Remarkably, the chromosomally integrated form of pTLC is adjacent to the CTX prophage. The strain distribution, chromosomal location and DNA sequence of pTLC suggests that it may be a genetic element that plays some role in the biology of CTXphi, perhaps facilitating either its acquisition or its replication. Analysis of this sequence revealed five potential ORFs predicted to encode proteins > 100 amino acids. BLAST searching revealed that most of these ORFs had little homology to known proteins (Rubin et al., 1998).

II. Epidemiology Information

Cholera is a worldwide disease with an estimated incidence of more than five million cases per year, most of which occur in Asia and Africa, with 8% of cases requiring hospitalization. Despite primarily affecting developing countries, cholera remains a serious public health problem for some developed countries (Pazzani et al., 2006). Cholera is a devastating disease, the epidemics of which, until 1992, were caused by Vibrio cholerae serogroup O1 biotype classical or El Tor. The classical biotype is believed to have caused the first six pandemics, which occurred in the Indian subcontinent and subsequently in other areas of the world between 1817 and 1923. V. cholerae O1 biotype El Tor was first reported in 1905. However, it was not until the early 1960s that V. cholerae biotype El Tor displaced the sixth-pandemic V. cholerae O1 classical biotype. The emergence in 1992 of a V. cholerae non-O1 serovar, designated V. cholerae synonym O139 Bengal, in Bangladesh and India and its subsequent appearance in Southeast Asia, displacing V. cholerae O1 El Tor, was considered a significant point in the history of cholera. V. cholerae O1 El Tor reemerged in 1994 to 1995, but V. cholerae O139 continues to coexist with V. cholerae O1 as indicated by its temporal quiescence and subsequent reemergence in 1997, 1999, and 2002 (Alam et al., 2006). Cholera has unique epidemiologic features. Perhaps the most intriguing are the predisposition to cause epidemics with pandemic potential and the ability to remain endemic in all affected areas (Seas and Gotuzzo, 2005). Epidemics of cholera caused by toxigenic V. cholerae O1 and O139 (Bengal strain) represent a major public-health problem in most developing countries. Even non-O1 non-O139 serogroups of V. cholerae, though reported less frequently, are increasingly being shown as the causative agents of cholera (Das and Gupta, 2005). Cholera has been epidemic in southern Asia for at least 1,000 years, but also spread worldwide to cause seven pandemics since 1817. When untreated, cholera is a disease of extraordinarily rapid onset and potentially high lethality. Although clinical management of cholera has advanced over the past 40 years, cholera remains a serious threat in developing countries where sanitation is poor, health care limited, and drinking water unsafe (Heidelberg et al., 2000). The first six pandemics, occurred in the Indian subcontinent and subsequently in other areas of the world between 1817 and 1923 (Alam et al., 2006). The pandemics arose in the Indian subcontinent, usually the Ganges delta, and spread to other continents, affecting many countries and extending over many years. British Isles and Canada: The second pandemic of cholera reached the British Isles in the early 1830s, and fundamental epidemiological observations by John Snow on the waterborne transmission of cholera were made in London between 1847 and 1854 during the late second and the third pandemics. The second pandemic also reached Canada via ships from Ireland carrying infected immigrants. During the third pandemic (1852 to 1859), cholera was rampant in the United States, and toward the end of the fourth pandemic (during the 1870s), cities and towns along the Mississippi, Missouri, and Ohio rivers experienced cholera. The fifth pandemic extensively affected South America; it caused large epidemics in many countries and was characterized by high mortality in Argentina, Chile, and Peru. During the fifth pandemic, Robert Koch isolated the causative organism of cholera, referred to as "comma bacilli", from rice water stools of patients in Egypt in 1883 and in India in 1884. The sixth pandemic (1899 to 1923) extensively involved populations in the near and middle East and the Balkan peninsula. Except for a large epidemic in Egypt in 1947, cholera remained virtually confined to south and southeast Asia from the mid-1920s until the onset of the seventh pandemic in 1961 (Faruque et al., 1998). In 1961, the seventh cholera pandemic began in Indonesia and spread throughout the world, reaching Africa in 1970 and South America in 1991 after an absence of > 100 years. Cholera has long been endemic in large parts of South Asia, but in the current pandemic, it has established endemicity throughout the African continent. The lack of infrastructure and economic development has made many parts of Africa susceptible to cholera, a disease associated with a lack of clean water and poor sanitation (Griffith et al., 2006). The spread of cholera to Sudan's Darfur region has caused international alarm, especially as it has arrived just at the start of the rainy season. Large areas are already cut off because of factional fighting, and the onset of the rains not only means that health workers can't reach many people but also heightens the risks of transmission. The World Health Organization says that 96 cases of acute watery diarrhoea and four deaths had been identified in the state of South Darfur by 14 June. A sample from one person who died, sent to Khartoum for testing, confirmed the presence of Vibrio cholerae, Inaba serotype (Moszynski, 2006). Outbreaks of cholera cause deaths estimated at 120,000 annually worldwide and many more cases each year, of which the vast majority occur in children. Hallmarks of the epidemiology of cholera include (i) a high degree of clustering of cases by location and season, (ii) highest rates of infection in children 1 to 5 years of age in areas of endemic infection, (iii) antibiotic resistance patterns that frequently change from year to year, (iv) clonal diversity of epidemic strains, and (v) protection against the disease by improved sanitation and hygiene and preexisting immunity. Cholera has been categorized as one of the "emerging and reemerging infections" threatening many developing countries. Several recent events that mark the epidemiological importance of the disease include the reemergence of cholera in Latin America in 1991; the explosive outbreak of cholera among Rwandan refugees in Goma, Zaire, which resulted in about 70,000 cases and 12,000 deaths in 1994; and the emergence of V. cholerae O139 in the Indian subcontinent during 1992 to 1993, possibly marking the beginning of the eighth pandemic of cholera (Faruque et al., 1998).

A. Outbreak Locations:
  1. Zaire: One of the worst cholera outbreaks occurred in Goma, Eastern Zaire, in July 1994. Conflicts between tribes in neighboring Rwanda had displaced nearly a million people to Zaire, and they were sheltered in refugee camps. Outbreak of cholera in the poverty-stricken refugee camps led to the death of an estimated 12,000 Rwandan refugees during a 3-week period. The seventh pandemic is ongoing, and it continues to cause seasonal outbreaks in many developing countries, especially Bangladesh and India (Faruque et al., 1998).
  2. Sudan: Between 28 January and 14 June 2006, a total of 16 187 cases, including 476 deaths of acute watery diarrhoea has been reported in 8 out of 10 states in southern Sudan. Vibrio cholerae 01 Inaba was laboratory confirmed in several stool samples (WHO - Epidemic and Pandemic Alert and Response (EPR)).
  3. Uganda: Between 2002 - 2003, El Nino phenomenon causing increased rainfall and flooding has been linked to flare ups and emergence of several disease outbreaks including cholera. The latter has been reported in many districts in Uganda in recent years. Cholera outbreaks occurred in all the study districts coincident with the onset of the El Nino rains. There were 924 cholera suspect cases reported with 95 fatalities (case fatality rate 10.3%). A total of 388 clinical specimens were analyzed by culture and of these, 168 were positive for V. cholerae. Biochemical and serological analysis identified the isolates as V. cholerae O1, biotype EL Tor serotype Ogawa. Antibiotic sensitivity revealed that isolates were 100% sensitive to ciprofloxacin, tetracycline and erythromycin, whereas sensitivity was variable for other tested antibiotics. Unlike Kampala, where the disease was contained within three months, persistence occurred in other districts only dying out with end of El Nino rains, suggesting differences in disease control (Alajo et al., 2006).
  4. Angola: Deaths from cholera are again making news, this time in Angola. According to the World Health Organization (WHO), Angola had reported 46,758 cases of cholera, including 1893 deaths, as of June 19, 2006.1 The outbreak has affected 14 of 18 provinces, but nearly half the cases were reported in the coastal capital, Luanda, and another 17 percent in Benguela provinces. The overall case fatality rate is about 4 percent, although in some provinces, it has reached 30 percent. This outbreak represents another in a series of cholera epidemics in this country (Sack et al., 2006).
  5. Tanzania: 1997 was marked by a cholera epidemic affecting most countries in East Africa, with spread toward central and southern parts of the continent. Africa reported 118,349 cases to the World Health Organization in 1997, for 80% of cases worldwide. Africa also had the highest overall case-fatality rate (4.9%), compared with 1.3% in the Americas and 1.7% in Asia. Tanzania has consistently reported cholera cases; annual reports ranged from 1,671 cases in 1977 to 18,526 in 1992. During the last 2 decades, three major cholera epidemics have occurred: 1977-78, 1992, and 1997. In 1997, Tanzania had one of the highest case-fatality rates in East Africa (5.6%), with 2,268 deaths in 40,226 cases (Acosta et al., 2001).
  6. Italy: El Tor cholera outbreaks first occurred in the southern regions of Apulia and Campania in 1973; there were a dozen cases in Sardinia in 1973 and 1979. Since then, except for sporadic imported cases, no cholera was detected in Italy until 1994, when the disease reappeared in Apulia in the same year as in the Balkans (Pazzani et al., 2006).
  7. India and Bangladesh: In late 1992, epidemic cholera was reported in Madras and other places in India and in Southern Bangladesh. Although the clinical syndrome was typical of cholera, the causative agent was a V. cholerae non-O1 strain, which was later serogrouped as O139. The epidemic continued through 1993, and V. cholerae O139 spread throughout Bangladesh and India and neighboring countries. Outbreaks or cases due to V. cholerae O139 have since been reported in Pakistan, Nepal, China, Thailand, Kazakhastan, Afghanistan, and Malaysia. Imported cases have been reported in the United Kingdom and the United States. Recent surveillance during 1996 and 1997 has shown that V. cholerae O139 continues to cause cholera outbreaks in India and Bangladesh and coexists with the El Tor vibrios. If outbreaks of cholera due to this new serogroup continue to occur and to affect more countries, this may represent the eighth pandemic (Faruque et al., 1998).
B. Transmission Information:
  1. From: Water To: Human
    Mechanism: The mechanisms of transmission for cholera include water, unwashed contaminated food, and seafood that comes from Vibrio cholerae endemic estuaries. In West, Southern, and East Africa, water source contamination was the second most common risk factor reported, representing 32%, 30%, and 24% of the total, respectively. In Central Africa, water source contamination was the most common, accounting for 30% of the reported risk factors (Griffith et al., 2006). The critical role of water in transmission of cholera has been recognized for more than a century. As previously noted, the classic demonstration of this came in 1854, during the second cholera pandemic, when the London physician and epidemiologist John Snow showed that illness was associated with consumption of water from a water system that drew its water from the Thames River at a point below major sewage inflows. In one illustrative study in Bangladesh, 44% of surface water sources in communities with cholera were culture positive for the organism; not unexpectedly, there was a significantly increased risk of infection associated with use of water from culture positive sources for cooking, bathing, or washing (but, interestingly, not with drinking). Water has also been implicated in spread of the South American epidemics. In case control studies in Trujillo and Piura, Peru, drinking unboiled water was significantly associated with illness; fecal contamination of municipal water was common, and in Trujillo, the epidemic strain of V. cholerae O1 was isolated from the municipal water supply (Kaper et al., 1995).

  2. From: Food To: Human
    Mechanism: The mechanisms of transmission for cholera include unwashed contaminated food, and seafood that comes from Vibrio cholerae endemic estuaries (Griffith et al., 2006). Cholera was associated with the consumption of unwashed fruit and vegetables, with eating food from street vendors and with contaminated crabmeat transported in travellers' luggage (Guthmann,1995). In South America and East Asia, the most commonly noted risk factor for cholera outbreaks was transmission associated with food, accounting for 32% in South America and 71% in East Asia (Griffith et al., 2006). Seafood may acquire the organism from environmental sources and may serve as a vehicle in both endemic and epidemic disease, particularly if it is uncooked or only partially cooked. There are also data suggesting that vegetables irrigated with untreated sewage can harbor and transmit V. cholerae O1. Food within households (or institutions) may be contaminated by food handlers, or water used in preparation of the food may contain the organism (as has been suggested in an outbreak of cholera that occurred on a U.S. Gulf Coast oil rig). A recent small cluster of cases in the United States was attributed to frozen coconut milk imported from Thailand: among other possible sources of introduction of the organism, canal water was used to wash the floor on which the coconut meat was chopped. As noted above, food buffers V. cholerae against killing by gastric acid. It can also provide an ideal culture medium: cooked rice, for example, has been shown to support rapid growth of V. cholerae, as do neutral sauces such as peanut sauce (more acidic sauces, with a pH of 5.0 and below, appear to provide protection against the organism). While food has been frequently implicated as a vehicle responsible for introduction of cholera into a new area, the potential advantages of food-borne transmission (protection against gastric acidity and opportunity for growth of the organism) raise the possibility that food plays a larger role than previously recognized in transmission in areas of endemicity. In keeping with this hypothesis, in studies in Piura, Peru, drinking unboiled water (62% of cases; odds ratio of 6.2), eating food from a street vendor (26% of cases; odds ratio of 17.5), and eating rice 0.3 hr old without reheating (32% of cases, odds ratio of 6.2) were all independently associated with illness (Kaper et al., 1995).

  3. From: Human To: Human
    Mechanism: Cholera can be transmitted not only by contaminated water but also by food. Social phenomena such as mass migrations and burial practices may play a greater role than previously understood (Glass et al., 1991).

C. Environmental Reservoir:
  1. Oyster :
    1. Ontology: UMLS:xxx
    2. Description: Although it is best known as the causative agent of the human disease cholera, Vibrio cholerae is also an autochthonous inhabitant of many aquatic environments, including estuarine and coastal waters (Purdy et al., 2005). The toxigenic Latin American strain of V. cholerae was isolated from Gulf Coast oysters during the summers of 1991 and 1992 (Alexander et al., 1998).
  2. Algae :
    1. Ontology: UMLS:xxx
    2. Description: Environmental V. cholerae has been detected in association with zooplankton and phytoplankton from the various aquatic environments of Bangladesh. It has been suggested that the enhanced survival of microorganisms in aquatic environments is due to the association with some living surfaces where they find nutrients and a favorable microenvironment. Islam et al. demonstrated that a bluegreen alga (cyanobacterium), Anabaena sp., can provide a microenvironment for protracted survival of V. cholerae O1 in both the microcosm and the aquatic environment of Bangladesh (Islam et al., 2002).
  3. Brakish water or salt water :
    1. Ontology: UMLS:xxx
    2. Description: Of interest, the niche that V. cholerae inhabits between epidemics is uncertain. The form of organism shed from infected humans is somewhat fragile and cannot survive long in the environment. However, evidence does suggest that survival, or dormant, stages of the bacillus exist to allow long-term survival in brackish water or salt water environments during interepidemic periods. Asymptomatic carriers of V. cholerae have been documented, but they are not thought to be a significant reservoir for maintaining the organism between outbreaks (Forbes et al., 2002).
  4. Acanthamoeba castellanii :
    1. Ontology: UMLS:xxx
    2. Description: Vibrio cholerae is the causative agent of cholera, a form of diarrhoea, which continues to rage and remains a major public health problem in the developing world. The organism has the capacity to survive in diverse estuarine environments, as well as in the human host. Recent studies have suggested that interaction with a freshwater amoeba, Acanthamoeba castellanii, could be one possible mode of survival in the aquatic environment. It was also shown that V. cholerae could replicate intracellularly in A. castellanii (Jain et al., 2006).
  5. Chironomids :
    1. Ontology: UMLS:xxx
    2. Description: The natural reservoir of the bacterium is environmental. A recent report indicated an association between V. cholerae and chironomid egg masses. Chironomids, the "non-biting midges" (Diptera; Chironomidae), are the most widely distributed and frequently the most abundant insects in freshwater. Females attach egg masses, each containing hundreds of eggs encased in a layer of gelatin, to the water's edge where bacteria are abundant and may encounter the nutrient-rich substrate. Halpern and co-workers reported the isolation of non-O1 and non-O139 V. cholerae from chironomid egg masses from different freshwater bodies in Israel, India, and Africa. Thirty-five different serogroups of V. cholerae were identified among the bacteria isolated from chironomids, demonstrating population heterogeneity. Two strains of V. cholerae O37 and O201 that were isolated from chironomid egg masses in Zanzibar Island were NAG-ST positive. These findings support the hypothesis that the association found between chironomids and the cholera bacteria is not a rare coincidence, indicating that chironomid egg masses may serve as yet another potential reservoir for V. cholerae (Halpern et al., 2004).
D. Intentional Releases:
  1. Intentional Release information :
    1. Description: Cholera is acquired through the ingestion of contaminated water or food. The disease manifests as a watery diarrhea so profuse that supplies of IV fluids are often exhausted during epidemics. Intentional use by belligerents or terrorist groups would presumably involve the contamination of food or water sources. Cholera is incapacitating, but in the face of large numbers of casualties, and the breakdown in medical care often associated with war, a large number of deaths are possible (United States Agency for International Development (USAIID)).
    2. Emergency contact: Since cholera outbreaks can become massive epidemics, they must be reported to national health authorities. If possible, cases of suspected cholera should be confirmed by bacteriology. Even without laboratory confirmation, cases should be reported if they meet the WHO definition: a cholera outbreak should be suspected if a patient older than 5 years develops severe dehydration or dies from acute watery diarrhoea, or if there is a sudden increase in the daily number of patients with acute watery diarrhoea, especially patients who pass "rice water" stools typical of cholera (Sack et al., 2004).
    3. Containment: In Mozambique, a novel surveillance system was introduced in Mpumalanga Province, a rural area in the north-east of South Africa, in an attempt to address deficiencies in the system of notification for infectious conditions that have the potential for causing outbreaks. Rapid detection, reporting and response to six imported cholera cases resulted in effective containment, with only 19 proven secondary cholera cases, during a two-year review period. No secondary cases followed detection. The primary goal of an outbreak surveillance system is to ensure timely recognition of syndromes requiring an immediate response. Infection control nurses in Mpumalanga hospitals have excelled in timely weekly zero-reporting, participation at monthly training and feedback sessions, detection of priority clinical syndromes, and prompt appropriate response (Durrheim et al., 2001). The simple syndrome-based outbreak surveillance system initially developed and evaluated in Mpumalanga Province, South Africa was adapted for the Pacific island nation of Tuvalu. Eight syndromes including profuse watery diarrhoea (cholera) were identified for surveillance. A user-oriented manual, the Tuvalu Outbreak Manual (http://www.wepi.org/books/tom/), was developed to support introduction of the surveillance system. Nurses working in seven outer island clinics and the hospital outpatient department on the main island rapidly report suspected outbreaks and submit weekly zero-reports to the central communicable disease control unit. An evaluation of the system after 12 months indicated that the Outbreak Manual was regarded as very useful by clinic nurses, and there was early evidence of improved surveillance and response to the disease syndromes under surveillance (Nelesone et al., 2006). For effective containment of outbreaks, patients with infectious diseases of public health importance must be recognized and promptly reported to those responsible for prevention and control activities. This is particularly important in under-resourced regions where delays in raising the alarm may cause vulnerable communities to suffer multiple generations of disease, with unnecessary morbidity, death, panic, and loss of public health system credibility. It is not sufficient to implement what appear to be viable surveillance systems, without ongoing monitoring, and, where indicated, critical review. The adaptation of the Mpumalanga Outbreak Manual for Tuvalu was successful and regarded as a valuable tool by reporting nurses. Although the early progress of outbreak surveillance and response in Tuvalu is encouraging, it demonstrates the challenging nature of communicable disease surveillance in developing countries and the need for ongoing monitoring and responsive adaptation to feedback from surveillance agents based in the periphery of the health system. Successful communicable disease surveillance depends on effective bidirectional information flow between clinicians at the periphery and communicable disease control units at regional, national and global levels. Resource-poor countries often struggle to establish and maintain the crucial link with the periphery (Nelesone et al., 2006).

III. Infected Hosts

  1. Human:
    1. Taxonomy Information:
      1. Species:
        1. Human, man :
          • Ontology: UMLS:xxx
          • GenBank Taxonomy No.: 9606
          • Scientific Name: Homo sapiens (NCBI Taxonomy)
          • Description: Vibrio cholerae O1 and V. cholerae O139 infect humans, causing the diarrheal and waterborne disease cholera, which is a worldwide health problem. Vibrio cholerae inhabits aquatic environments and human intestines, and cholera outbreaks are associated with contaminated food and water supplies (author et al., 2007).

    2. Infection Process:
      1. Infectious Dose: The infective dose of V. cholerae has been estimated as 10(8) - 10(9) cells (author et al., 2007). Doses of 10(11) CFU of V. cholerae were required to consistently cause diarrhea in healthy North American volunteers when the inoculum was given in buffered saline (pH 7.2). When stomach acidity was neutralized with 2 g of sodium bicarbonate immediately prior to administration of the inoculum, attack rates of 90% were seen with an inoculum of 10(6). Food has a buffering capacity comparable to that seen with sodium bicarbonate. Ingestion of 10(6) vibrios with food such as fish and rice resulted in the same high attack rate (100%) as when this inoculum is administered with buffer. Fewer data are available on inoculum size in naturally occurring infections. Studies in Bangladesh have led to the suggestion that the inoculum in nature is in the range of 10(2) to 10(3) (Kaper et al., 1995).
      2. Description: Susceptibility to cholera depends also on largely unknown host factors. Individuals of blood group O are at increased risk of more severe cholera, which has been shown for natural infection as well as with experimental infection. Interestingly, the population of South America has one of the highest incidences of blood group O in the world, while the population of Bangladesh has one of the lowest incidences of this blood group (Kaper et al., 1995). In the natural habitat food, such as seafood, is thought to be contaminated with pathogenic Vibrio spp. via water. The numbers of Vibrio spp. may incease in the seafood due to biological concentration in fish and shellfish, especially bivalve molluscs. Cholera is not always a waterborne disease. Contamination of food followed by an increase in the number of vibrios may lead to foodborne cholera. In endemic areas food, such as vegetables, can become contaminated with V. cholerae via irrigation water, human faeces or sewage. Direct contamination by food handlers excreting the organism with or without symptoms is another route of transmission to a wide variety of foods. Outside the natural habitat V. cholerae can grow above 10 C on non-acid foods with a low number of competitive organisms (cooked foods) and a water activity greater than 0.93 (Donovan and van Netten, 1995).

    3. Disease Information:
      1. Cholera (i.e., Cholera) :
        1. Pathogenesis Mechanism: The major features of the pathogenesis of cholera are well established. Infection due to V. cholerae begins with the ingestion of contaminated food or water containing the organism. After passage through the acid barrier of the stomach, the vibrio colonizes the epithelium of the small intestine by means of the TCP and other factors. Cholera enterotoxin produced by the adherent vibrios (and possibly other toxins) disrupts ion transport by intestinal epithelial cells. The subsequent loss of water and electrolytes leads to the severe diarrhea characteristic of cholera. Although the major features of the pathogenesis of V. cholerae are well established, there are still significant questions which are unanswered for several aspects of the disease process (Kaper et al., 1995). Volunteer challenge studies with V. cholerae have been extremely useful in studying many aspects of cholera. These studies, in which consenting informed adults are experimentally infected with V. cholerae under quarantine conditions, have yielded many insights into pathogenesis and host immune response. Early studies by Cash et al. established that in fasting North American volunteers, approximately 10(11) V. cholerae organisms were required to induce diarrhea unless Sodium bicarbonate was administered to neutralize gastric acid. Further studies by Levine et al. demonstrated that most volunteers who receive as few as 10(3) to 10(4) organisms with buffer develop diarrhea, although lower inocula correlated with a longer incubation period and decreased stool volumes (i.e., diminished severity). In addition to gastric acidity, other host factors, as yet poorly defined, play a role in disease susceptibility. The effect of other host factors is illustrated by a study in which the identical inoculum that caused 44 liters of diarrhea in one volunteer caused little or no illness in other individuals. One correlation with increased host susceptibility is blood type. Individuals of blood group O have more severe disease than those of other blood groups, but the mechanism responsible for this difference is not known (Kaper et al., 1995). The crucial role of CT in disease was clearly shown by Levine et al., who fed purified CT to volunteers. Ingestion of 25 mg of pure CT (administered with cimetidine and NaHCO3 to diminish gastric acidity) caused over 20 liters of rice water stool, and ingestion of as little as 5 mg of pure CT resulted in 1 to 6 liters of diarrhea in five of six volunteers. These studies suggested that the severe purging characteristic of cholera was due to a single toxin. However, later studies with genetically engineered V. cholerae strains specifically deleted for ctx genes encoding one or both subunits of CT demonstrated that milder diarrhea could result even in the absence of CT. Thus, although CT is responsible for the profuse diarrhea of cholera, there are still additional secretogenic factors expressed by V. cholerae. Other aspects of the pathogenesis of cholera have been answered by using the volunteer model. The essential roles of the TCP colonization factor and the ToxR regulatory system in virulence were demonstrated in volunteer studies conducted by Herrington et al. Conversely, volunteer studies also demonstrated that V. cholerae O1 strains isolated from sewage water in Brazil which lacked genes encoding CT and the TCP colonization factor could not colonize the intestine well, cause disease, or elicit strong vibriocidal responses. Finally, volunteer studies have played a crucial role in evaluating host immune response and vaccine efficacy (Kaper et al., 1995).


        2. Incubation Period: After an incubation period ranging from hours to a few days, profuse watery diarrhea (rice-water stools) begin (Strohl et al., 2001). The incubation period of cholera can range from several hours to 5 days and is dependent in part on inoculum size (Kaper et al., 1995).


        3. Prognosis: Cholera is a medical emergency that can have a favourable prognosis with properly organized management (Ndour et al., 2006). The disease runs its course in 2 to 7 days; the outcome depends upon the extent of water and electrolyte loss and the adequacy of water and electrolyte repletion therapy (Finkelstein, 1996).


        4. Diagnosis Overview: The diagnosis is suggested by strikingly severe, watery diarrhea. For rapid diagnosis, a wet mount of liquid stool is examined microscopically. The characteristic motility of vibrios is stopped by specific antisomatic antibody. Other methods are culture of stool or rectal swab samples on TCBS agar and other selective and nonselective media; the slide agglutination test of colonies with specific antiserum; fermentation tests (oxidase positive); and enrichment in peptone broth followed by fluorescent antibody tests, culture, or retrospective serologic diagnosis. More recently the polymerase chain reaction (PCR) and additional genetically-based rapid techniques have been recommended for use in specialized laboratories (Finkelstein, 1996). Rapid bacteriologic diagnosis offers relatively little clinical advantage to the patient with secretory diarrhea, because essentially the same treatment (fluid and electrolyte replacement) is employed regardless of etiology. Nevertheless, rapid identification of the agent can profoundly affect the subsequent course of a potential epidemic outbreak. Because of their rapid growth and characteristic colonial morphology, V. cholerae can be easily isolated and identified in the bacteriology laboratory, provided, first, that the presence of cholera is suspected and, second, that suitable specific diagnostic antisera are available. The vibrios are completely inhibited or grow somewhat poorly on usual enteric diagnostic media (MacConkey agar or eosin-methylene blue agar). An effective selective medium is thiosulfate-citrate-bile salts-sucrose (TCBS) agar, on which the sucrose-fermenting cholera vibrios produce a distinctive yellow colony. However, the usefulness of this medium is limited because serologic testing of colonies grown on it occasionally proves difficult, and different lots vary in their productivity. This medium is also useful in isolating V. parahaemolyticus. They can also be isolated from stool samples or rectal swabs from cholera cases on simple meat extract (nutrient) agar or bile salts agar at slightly alkaline pH values. Following observation of characteristic colonial morphology with a stereoscopic microscope using transmitted oblique illumination, microorganisms can be confirmed as cholera vibrios by a rapid slide agglutination test with specific antiserum. Classic and El Tor biotypes can be differentiated at the same time by performing a direct slide hemagglutination test with chicken erythrocytes: all freshly isolated agar-grown El Tor vibrios exhibit hemagglutination; all freshly isolated classic vibrios do not. In practice, this can be accomplished with material from patients as early as 6 hours after streaking the specimen in which the cholera vibrios usually predominate. However, to detect carriers (asymptomatically infected individuals) and to isolate cholera vibrios from food and water, enrichment procedures and selective media are recommended. Enrichment can be accomplished by inoculating alkaline (pH 8.5) peptone broth with the specimen and then streaking for isolation after an approximate 6-hour incubation period; this process both enables the rapidly growing vibrios to multiply and suppresses much of the commensal microflora. The classic case of cholera, which includes profound secretory diarrhea and should evoke clinical suspicion, can be diagnosed within a few minutes in the prepared laboratory by finding rapidly motile bacteria on direct, bright-field, or dark-field microscopic examination of the liquid stool. The technician can then make a second preparation to which a droplet of specific anti-V cholerae O group 1 antiserum is added. This quickly stops vibrio motility. Another rapid technique is the use of fluorescein isothiocyanate-labeled specific antiserum (fluorescent antibody technique) directly on the stool or rectal swab smear or on the culture after enrichment in alkaline peptone broth. For cultural diagnosis, both nonselective and selective (TCBS) media may be used. Although demonstration of typical agglutination essentially confirms the diagnosis, additional conventional tests such as oxidase reaction, indole reaction, sugar fermentation reactions, gelatinase, lysine, arginine, and ornithine decarboxylase reactions may be helpful. Tests for chicken cell hemagglutination, hemolysis, polymyxin sensitivity, and susceptibility to phage IV are useful in differentiating the El Tor biotype from classic V cholerae. Diagnosis can be made retrospectively by confirming significant rises in specific serum antibody titers in convalescents. For this purpose, conventional agglutination tests, tests for rises in complement-dependent vibriocidal antibody, or tests for rises in antitoxic antibody can be employed. Convenient microversions of these tests have been developed. Passive hemagglutination tests and enzyme-linked immunosorption assays (ELISAs) have also been proposed. Cultures that resemble V cholerae but fail to agglutinate in diagnostic antisera (nonagglutinable or non-O group 1 vibrios) present more of a problem and require additional tests such as oxidase, decarboxylases, inhibition by the vibriostatic pteridine compound 0/129, and the "string test". The string test demonstrates the property, shared by most vibrios and relatively few other genera, of forming a mucus-like string when colony material is emulsified in 0.5 percent aqueous sodium deoxycholate solution. Genetically based tests such as PCR are increasingly being used in specialized laboratories (Finkelstein, 1996).


        5. Symptom Information :
          • Syndrome -- Cholera gravis:
            • Description: Cholera is a clinical - epidemiologic syndrome caused by Vibrio cholerae, usually of serogroup O1. In its severe form, cholera gravis, the clinical disease is characterized by the passage of voluminous stools of rice water character that rapidly lead to dehydration. Hypovolemic shock, acidosis, and death can ensue in adults, as well as in children, if prompt and appropriate treatment is not initiated. In cholera gravis, the rate of diarrhea may quickly reach 500 to 1,000 ml per hour, leading rapidly to tachycardia, hypotension, and vascular collapse due to dehydration. Peripheral pulses may be absent, and blood pressure may be unobtainable. Skin turgor is poor, giving the skin a doughy consistency; the eyes are sunken; and hands and feet become wrinkled, as after long immersion ("washerwoman's hands"). Phonation is impaired, and the patient speaks in a whisper. Patients are restless and extremely thirsty. Major alterations in mental status are uncommon in adults; the patient usually remains well oriented but apathetic, even in the face of severe hypovolemic shock (Kaper et al., 1995). Several complications can occur with cholera, but these are generally from improper treatment. They include acute renal failure from protracted hypotension if insufficient fluids are given. Most cholera patients have low blood glucose concentrations, and a few have severe hypoglycaemia. Electrolyte imbalance, especially hypokalaemia, can occur if the intravenous fluids are not appropriate. Miscarriage or premature delivery can occur in pregnant women as a complication of shock and poor perfusion of the placenta. With good hydration, these obstetric emergencies are becoming less frequent, but cholera treatment centres must be prepared for them (Sack et al., 2004).
            • Observed: Only a minority of persons infected with CT-producing V. cholerae develop the most severe manifestations of the disease, termed cholera gravis. Infections with classical strains are generally more severe than those with El Tor strains. It has been estimated that 11% of patients with classical infections develop severe disease compared with 2% of those with El Tor infections. While cholera gravis is a striking clinical entity, milder illnesses are not readily differentiated from other causes of gastroenteritis in cholera-endemic areas (Kaper et al., 1995).


            • Symptoms Shown in the Syndrome:

            • Diarrhea:
              • Ontology: UMLS:xxx
              • Description: The hallmark symtom is the profuse watery diarrhea. In acute cases, the stools acquire a characteristic "rice water" appearance in which the mucus that lines the intestines becomes suspended in the fluid, resulting in a milky or rice water appearance. Over the course of 3 days, up to 90 liters of diarrhea may be produced (Prouty and Klose, 2006). Onset of illness may be sudden, with profuse, watery diarrhea, or there can be premonitory symptoms such as anorexia, abdominal discomfort, and simple diarrhea. Initially the stool is brown with fecal matter, but soon the diarrhea assumes a pale gray color with an inoffensive, slightly fishy odor. Mucus in the stool imparts the characteristic rice water appearance. Tenesmus is absent; instead, there is often a feeling of relief as enormous amounts of fluid are passed effortlessly (Kaper et al., 1995).
              • Observed: 95% (Ndour et al., 2006) 100% (Matsushita et al., 1997)
            • Dehydration:
              • Ontology: UMLS:xxx
              • Description: The massive loss of fluids leads to severe dehydration that, if untreated, leads to circulatory failure and ultimately death (Prouty and Klose, 2006). Signs of severe dehydration include absent or low-volume peripheral pulse, undetectable blood pressure, poor skin turgor, sunken eyes, and wrinkled hands and feet (as after long immersion in water). At first, patients are restless and extremely thirsty, but as shock progresses, they become apathetic and may lose consciousness. Many patients also show respiratory signs of metabolic acidosis with Kussmaul, gasping breathing. Most patients have no urine output until the dehydration is corrected. The fluid loss may be so rapid that the patient is at risk of death within a few hours of onset, and most deaths occur during the first day. However, if rehydration fluids are provided in insufficient quantities, the patient may survive temporarily, only to die a few days later (Sack et al., 2004). Dehydration is reflected in a higher plasma protein concentration, hematocrit, serum creatinine, urea nitrogen, and plasma specific gravity. Stool bicarbonate losses and lactic acidosis associated with dehydration can result in severe acidosis manifested by depression of blood pH and plasma bicarbonate and an increased serum anion gap (mean of 20.2 mmol/liter in one study). The isotonic dehydration results in serum sodium and chloride concentrations which are usually within the normal range. Despite profound potassium loss, uncorrected acidosis may result in a normal or high serum potassium level. However, loss of cellular potassium can lead to hypokalemic nephropathy and focal myocardial necrosis. Ischemic renal tubular necrosis due to prolonged circulatory collapse may be seen in patients in whom treatment is long delayed or inadequate. Hypoglycemia with coma and convulsions may occur in children (Kaper et al., 1995).
            • Vomiting:
              • Ontology: UMLS:xxx
            • Muscle cramps:
              • Ontology: UMLS:xxx
              • Description: Severe muscle cramps of arms and legs are common. They are probably due to the electrolyte imbalance, although the exact explanation is not known. They subside within a few hours of treatment (Sack et al., 2004).
          • Loss of skin turgor:
            • Description: Loss of skin turgor, scaphoid abdomen, and weak pulse are characteristic of cholera. Various degrees of fluid and electrolyte loss are observed, including mild and subclinical cases (Finkelstein, 1996).
          • Fever:
            • Description: Body temperature usually is normal or subnormal, although low-grade fever in up to 20% of individuals can occur (Kaper et al., 1995).
          • Oliguria:
            • Description: Oliguria may be present until dehydration and electrolyte deficiencies are corrected (Kaper et al., 1995).
          • Abdominal pain:

        6. Treatment Information:
          • Rehydration Therapy: Intravenous rehydration: For adults, the intravenous replacement solution should be infused as rapidly as possible so that about 2 liters is given in the first 30 min. If at this point the patient's clinical condition improves, the infusion can be slowed to deliver approximately 100 ml/kg of body weight within the first 4 h of therapy. Children in shock should receive 30 ml of intravenous fluid per kg of body weight in the first hour and an additional 40 ml/kg in the next 2 h. The intravenous fluid chosen for rehydration should be adequate to replace the isotonic fluid and electrolyte losses of cholera. The World Health Organization (WHO) recommends Ringer's lactate as the best commercial solution. Since this solution does not have sufficient potassium, potassium chloride may be added to the bottle (10 meq/liter) or given orally. Isotonic saline corrects hypovolemia, but potassium, base, and glucose must be supplemented. The hypoglycemia that is sometimes seen in pediatric patients should be treated with 25 or 50% glucose given intravenously (Kaper et al., 1995). Oral rehydration: Patients with mild or moderate dehydration can receive initial fluid replacement to repair water and electrolyte deficits exclusively by the oral route. For mild dehydration, the WHO recommends ORS be given in a volume of 50 ml/kg within the first 4 h. For moderate dehydration, twice this volume (100 ml/kg) should be given in the same time period. Vomiting rarely prevents successful use of ORS and is not a contraindication to its use. Stool output must be carefully monitored; in epidemic areas, this is often done with a "cholera cot," which contains a hole strategically cut to permit collection of diarrheal stool in a container placed under the cot. After initial stabilization by either intravenous or oral fluids, ongoing stool losses in adults should be replaced with ORS at a ratio of 1.5:1 (i.e., 150 ml of ORS for every 100 ml of diarrheal stool passed). For children, who tend to have lower concentrations of sodium in their stool, fluid losses should be replaced 1:1 with ORS. In developing countries there has been some success in the use of common, locally available sugar and salt products for preparing ORS. There has also been much interest in the use of complex carbohydrates, such as those found in rice gruel, in these solutions (Kaper et al., 1995). For cholera, ORS that uses rice rather than glucose is even better because it reduces the purging rate; this form is also available in packets to be mixed with water. The preferred formulation of ORS has changed lately; the sodium concentration has been lowered to 75 mmol/L. During the first 24 h, patients must be observed closely because the purging might continue at a high rate and some patients have difficulty drinking sufficient quantities of ORS, or vomiting can prevent sufficient oral intake. Such patients will become dehydrated and require intravenous infusion again. Patients can be fed as soon as they are able to take food. There is no need to restrict food or fluids, and babies can continue to breastfeed (Sack et al., 2004).
            • Applicable: The key to therapy is provision of adequate rehydration until the disease has run its course (usually 1 to 5 days in the absence of antimicrobial therapy). Rehydration can be accomplished by intravenous infusion of fluid (in severe cases) or by oral rehydration with an oral rehydration solution (ORS) (Kaper et al., 1995). ORS is the preferred therapy for patients who have no detectable dehydration or some dehydration. It is also used to maintain hydration to make up for continuing losses after correction of severe dehydration with intravenous fluids. Packets of of oral rehydration solutes, containing carbohydrate and the correct salts are now widely available throughout the world (Sack et al., 2004).
            • Success Rate: One hundred seventy-six patients who were hospitalized with acute diarrhoea and signs of severe dehydration were rehydrated intravenously and then randomly assigned to receive either standard ORS solution (311 mmol/L) or reduced-osmolarity ORS solution (245 mmol/L). Intakes and outputs were measured every six hours until the cessation of diarrhoea. During maintenance therapy, stool output, intake of ORS solution, duration of diarrhoea, and the need for unscheduled administration of intravenous fluids were similar in the two treatment groups. The type of ORS solution that the patients received did not affect the mean serum sodium concentration at 24 hours after randomization and the relative risk of development of hyponatraemia. However, patients treated with reduced-osmolarity ORS solution had a significantly lower volume of vomiting and significantly higher urine output than those treated with standard WHO-ORS solution. Reduced-osmolarity ORS solution was as efficacious as standard WHO-ORS solution in the management of cholera patients. The results indicate that reduced-osmolarity ORS solution is also as safe as standard WHO-ORS solution. However, because of the limited sample size in the study, the results will have to be confirmed in trials, involving a larger number of patients (Pulungsih et al., 2006).
          • Antimicrobial therapy: Tetracyclines: Tetracycline [500mg qid for 3 days] and doxycycline [300mg single dose] are the drugs of choice in treatment of cholera in adults (http:// www.who.int/cholera). In children the effective single dose therapy has not been identified (Alam et al., 2006). Doxycycline: Children 6 (mg/kg) in one single dose (Kaper et al., 1995). Tetracycline may provide some protection when given prophylactically within a family in which cases of cholera have occurred. However, widespread use of tetracycline prophylaxis has been associated with rapid development of antimicrobial resistance and should be strongly discouraged (Kaper et al., 1995).
            • Applicable: Antimicrobial agents can shorten the duration of cholera diarrhea and the period of excretion of vibrios. Treatment should be started after vomiting subsides (i.e., after initial rehydration and correction of acidosis) (Kaper et al., 1995).
            • Contraindicator: In children, it is well known that the adverse effects like enamel and skeletal defects associated with tetracyclines occur on prolonged use (Alam et al., 2006). Use of tetracycline in children < 8 years of age remains somewhat controversial, because of the possibility of staining of permanent teeth. However, the short courses recommended (12.5 mg/kg, four times per day for 3 days) should pose a minimal hazard (Kaper et al., 1995).
            • Success Rate: A randomized prospective trial in 65 patients was performed to determine the efficacy of single-dose doxycycline in the treatment of cholera. Treatment consisted of either a single dose of 200 mg of doxycycline (or 4 mg/kg in patients less than 15 years old) or multiple doses of doxycycline, 500 mg over 4 days (or 10 mg/kg in patients less than 15 years old). There were no differences between the groups in the volumes of intravenous fluid required, volumes of diarrheal stool, or durations of diarrhea. The mean duration of positive stool cultures for Vibrio cholerae was similar for the two groups, although in both groups several patients continued to excrete Vibrios in the stool for more than 3 days. Blood levels of antibiotic demonstrated that the doxycycline was absorbed in spite of the rapid transit time associated with severe diarrhea. These results suggest that although tetracycline remains the drug of choice for cholera, doxycycline is a reasonable alternative, and that a single dose of 200 mg (4 mg/kg in children) is effective clinically (Sack et al., 1978). A randomized, double-blind, placebo-controlled clinical trial was conducted to evaluate the efficacy of tetracycline in the treatment of adults with severe cholera due to V. cholerae O139 Bengal. Forty-three adult males with severe cholera were randomly allocated to receive either 500 mg of tetracycline (n=21) or placebo (n=22) for three consecutive days. Demographic and clinical characteristics of these patients on admission were comparable. Tetracycline therapy was associated with significantly reduced total median (inter-quartile range) stool volume [216.48 (90.18-325.22) mL/kg vs 334.25 (215.12-537.64) mL/kg; p=0.001], higher rates of clinical cure (81% vs 27%; p<0.001), and shorter median (inter-quartile range) duration of diarrhoea [32 (24-48) hours vs 80 (48-104) hours; p<0.001]. The mean +/- (SD) requirement of intravenous fluid was not significantly different between the two groups [146.42 +/- 42.12 mL/kg vs 150.44 +/- 27.21 mL/kg; p=0.70]. The median (inter-quartile range) duration of fecal excretion of V. cholerae O139 was significantly shorter in the tetracycline group than the placebo group [1(1-2) day vs 5 (3-6) days; p<0.001]. The results of the study indicate that tetracycline therapy is clinically useful in the treatment of severe cholera due to V. cholerae O139 Bengal (Hossain et al., 2002). A single 300 mg dose of doxycycline is as effective as the standard multiple dose tetracycline treatment for cholera in terms of stool output, duration of diarrhoea, vomiting, and requirement for oral rehydration solution (Alam et al., 1990). Alam and co-workers used single dose doxycycline (5 mg/kg). Forty of the 45 vibrio cholarae isolates from children (between July 2003 & Sept 2004) were 01 El tor Ogawa and the rest 5 were non 01 & non 0139. Ninety percent of these cases responded to single dose doxycycline (Alam et al., 2006).
            • Drug Resistance: Levels of tetracycline resistance in East Africa, Bangladesh, and parts of India have become high enough that V. cholerae isolates from these areas should be assumed to be tetracycline resistant until results of susceptibility testing are available. The widespread use of tetracycline prophylaxis has been associated with rapid development of antimicrobial resistance and should be strongly discouraged (Kaper et al., 1995). The incidence of tetracycline-resistant O1 El Tor strains in Bangladesh was 1.9% in 1990, 7.6% in 1991, 61.1% in 1992, and 85.4% in 1993. In contrast, in India, tetracycline resistance is not frequently found in O1 El Tor strains (Yamamoto et al., 1995). Endemic cholera has been prevalent in Douala since 1972, with sudden epidemic outbreaks occurring every two years during the dry season. The massive and systematic use of chemoprophylaxis since April, 1983 has led to the selection of strains of Vibrio cholerae eltor that are resistant to sulphamide and tetracycline. During the 1984-1985 epidemic, 89.3% of the isolated strains were resistant to sulphamides, 87.5% to a sulfamethoxazole-trimethoprim combination and to the 0/129 disk, 55.3% to tetracycline, 91.1% to chloramphenicol, 73.2% to streptomycin and 94.6% to ampicillin. The epidemic aspect of this multiple resistance to antibiotics raises the issue of the role of a group C incompatibility resistance plasmid (Garrigue et al., 1986). In a randomised controlled comparison of single-dose ciprofloxacin and doxycycline for cholera caused by Vibrio cholerae O1 or O139, all but one of the V cholerae O1 and all of the O139 isolates were susceptible in vitro to doxycycline, whereas 48 (37%) of the V cholerae O1 isolates and none of the O139 isolates were resistant to tetracycline. Treatment clinically failed in 14 (52%) of 27 doxycycline-treated patients infected with a tetracycline-resistant V cholerae O1 strain, compared with three (8%) of 37 patients infected with a tetracycline-susceptible strain (44%) (Khan et al., 1996).
          • Antibiotics: Fluoroquinolines: High degree of sensitivity of Vibrio cholerae to fluoroquinolones and cephalosporins has been reported. Successful treatment in 60% cases, but with high relapse rate, with single dose ciprofloxacin [20 mg/kg] was seen in a recent study. The high cost and multiple dose schedules of these drugs are the limitations to their usage (Alam et al., 2006).
            • Applicable: Single-dose ciprofloxacin is effective in the treatment of cholera caused by V cholerae O1 or O139 and is better than single-dose doxycycline in the eradication of V cholerae from stool. Single-dose ciprofloxacin may also be the preferred treatment in areas where tetracycline-resistant V cholerae are common (Khan et al., 1996).
            • Contraindicator: Ciprofloxacin is contraindicated in patients with a history of hypersensitivity to the drug or to other quinolones. Ciprofloxacin, like other quinolones, can cause serious, potentially fatal hypersensitivity reactions, occasionally following the intial dose. Patients receiving ciprofloxacin should be advised of this possibility and instructed to discontinue the drug and contact their physician at the first sign of rash or any other sign of hypersensitivity (AHFS Drug Information, 2006(b)).
            • Success Rate: In a randomised controlled study of ciprofloxacin for cholera caused by Vibrio cholerae O1 or O139, treatment was clinically successful in 62 (94%) of 66 patients infected with V. cholerae O1, and 54 (92%) of 59 patients infected with V. cholerae O139 (Khan et al., 1996).
            • Drug Resistance: Analysis of antibioticograms of 390 O1 and O139 serogroup Vibrio cholerae strains isolated from humans within 1927-2005 in various regions of the world showed that the strains of V. cholerae isolated within 1927-1966 were susceptible to 22 antibacterials, the strains isolated within 1938-1993 possessed 1-3 resistance markers and the strains isolated within 1994-2005 had 3-8 resistance markers including resistance to fluoroquinolones. All the strains of O139 serogroup V. cholerae isolated in 1993 and 1994 possessed 3 resistance markers. Cholera due to the V. cholerae eltor 1 strain (P-18826, 2005) isolated from a cholera patient, which was highly resistant to nalidixic acid, streptomycin, ampicillin and trimethoprim/sulfamethoxazole and showed cross resistance to fluoroquinolones (ciprofloxacin, ofloxacin, pefloxacin and norfloxacin) and moderate resistance to ceftriaxone and cefotaxime, revealed that the only efficient antibiotics were tetracyclines and aminoglycosides (except streptomycin) (Ryzhko et al., 2005). During the cholera epidemic of 2002 in and around Hubli, south India, Vibrio cholerae strains resistant to fluoroquinolones were isolated. Among the isolates of V. cholerae non-O1, non-O139 serogroups, 55.9% and 47.1% were resistant to norfloxacin and ciprofloxacin, respectively. However, only 12.5% of the O1 serogroup strains were resistant to both norfloxacin and ciprofloxacin. Though the O139 serogroup strains were susceptible to these antibiotics, they exhibited high-level resistance to nalidixic acid. This is a very disturbing finding, as nalidixic acid resistance can eventually lead to fluoroquinolone resistance among the O139 strains (Krishna et al., 2006).
          • Antibiotic: Azithromycin: Single dose of azithromycin [20 mg/kg max: 1 gm] as an alternative treatment has also been reported. The high cost of the drug is the major disadvantage (Alam et al., 2006).
            • Applicable: Azithromycin has been used as a first-line agent for the treatment of symptomatic enteric infections. Oral Azithromycin is used as an alternative to fluoroquinolones for the treatment of travellers' diarrhea (AHFS Drug Information, 2006(a)). Single-dose azithromycin was effective in the treatment of severe cholera in children and adults (Saha et al., 2006).
            • Contraindicator: Azothromycin is contraindicated in patients with known hypersensitivity to azithromycin, erythromycin, and any macrolide or ketolide antibiotic. Serious hypersensitivity reactions, including angioedema, anaphylaxis, and dermatologic reactions, have occurred rarely in patients receiving azithromycin. Because concomitant use of pimozide and other macrolides (e.g., clarothromycin) has increased pimozide concentrations and is associated with a risk of prolong QT interval and serious cardiovascular effects, the manufacturer of pimozide states that concomitant use of pimozide and macrolides (including azithromycin) is contraindicated (AHFS Drug Information, 2006(a)).
            • Complication: In a patient receiving long-term therapy with lovastatin, administration of oral azithromycin (250 my daily for 5 days) appeared to precipitate rhabdomyolysis (AHFS Drug Information, 2006(a)).
            • Success Rate: A double-blind, randomized trial comparing the equivalence of azithromycin and ciprofloxacin (each given in a single 1-g dose of two 500-mg tablets) among 195 men with severe cholera caused by Vibrio cholerae O1 or O139 was conducted. Therapy was clinically successful in 71 of 97 patients receiving azithromycin (73 percent) and in 26 of 98 patients receiving ciprofloxacin (27 percent) (P<0.001) and bacteriologically successful in 76 of 97 patients receiving azithromycin (78 percent) and in 10 of 98 patients receiving ciprofloxacin (10 percent) (P<0.001). Patients who were treated with azithromycin had a shorter duration of diarrhea than did patients treated with ciprofloxacin (median, 30 vs. 78 hours) (Saha et al., 2006).

        7. Other Information:
          • Recombinant probiotic: Focareta and co-workers have developed a therapeutic strategy based on molecular mimicry of host receptors for bacterial toxins on the surface of harmless gut bacteria. This has been applied to the development of a recombinant probiotic for treatment and prevention of cholera, caused by Vibrio cholerae. Glycosyltransferase genes from Neisseria gonorrhoeae and Campylobacter jejuni was expressed in a harmless Escherichia coli strain, resulting in production of a chimeric lipopolysaccharide terminating in a mimic of the ganglioside GM. The recombinant bacterium was capable of binding cholera toxin, a sine qua non of virulence, with high avidity; when tested with purified cholera toxin, it was capable of adsorbing >5% of its own weight of toxin in vitro. Administration of the GM-expressing probiotic also protected infant mice against challenge with virulent V cholerae, even when treatment was delayed until after establishment of infection. When treatment commenced 1 hour after challenge, 12 of 12 mice given the probiotic survived, compared with only 1 of 12 for control mice (P <.00001). Toxin-binding probiotics such as that described here have considerable potential for prophylaxis and treatment of cholera in humans (Focareta et al., 2006).

    4. Prevention:
      1. Vaccination:
        • Ontology: UMLS:xxx
        • Description: Safe, highly protective oral cholera vaccines have replaced the old injectable cholera vaccine with its justifiedly poor reputation. Currently, one internationally licensed oral cholera vaccine can be used for preventive vaccination campaigns. This vaccine has been deployed in a mass vaccination campaign in a cholera-endemic area of Mozambique and proved in principle that mass cholera vaccine campaigns are feasible, safe and protective. Technology to produce oral cholera vaccine is being transferred to India, which should ensure a cheap supply of large amounts of oral cholera vaccine, and the evaluation a new, cheap, singledose oral cholera vaccine is underway (von Seidlein, 2006).
        • Efficacy:
          • Rate: Receipt of one or more doses of OCV was associated with 78 percent protection (95 percent confidence interval, 39 to 92 percent) and assuming a similar performance as OCVs have shown in studies in Asia 50% or more protection can be expected for at least 3 years. Vaccine campaigns in Darfur, Sudan and Aceh, Indonesia have proven that cholera vaccination campaigns are feasible in complex emergencies (von Seidlein, 2006).
      2. Environmental sanitation:
        • Ontology: UMLS:xxx
        • Description: The importance of environmental sanitation in the control of cholera has long been emphasised but proved in the controlled field trials only recently. In fact it is the only effective approach known at present to the problem of control of cholera and its eventual eradication. Experience during the current pandemic of cholera since 1961 has shown that the attainment of high standards of sanitation and personal hygiene would not only make a country free of cholera but also make it non-receptive to cholera infection and thus bring about a permanent solution to the problem. The disease failed to get a foot-hold in Japan, Australia, France, United Kingdom, and Sweden, where the infection had been introduced repeatedly (Shrivastav, 1974).
      3. Environmental sanitation: Excreta disposal:
        • Ontology: UMLS:xxx
        • Description: In the rural areas and bustees around towns, careles defecation by the people must be prevented by education and compulsion if necessary. This should be supported by the construction of temporary trench-type latrines which should be maintained and clean to encourage their use. Adequate use of powdered chlorine should be made to sprinkle over excreta and soiled surface in and around the latrines. In the towns, the maintenance of service latrines should be supervised strictly to ward off the danger both to the staff handling them and to the general public. The safe disposal of excreta should be ensured so that possible contamination of water sources is prevented and there is no exposure to flies. Use of night soil as a fertiliser should be prohibited, and sewage farming, if at all allowed, be strictly supervised. Where sewage from sewerage system is disposed in river, lake, sea etc., it should be adequately chlorinated before being discharged (Shrivastav, 1974).
      4. Environmental sanitation: Water supply:
        • Ontology: UMLS:xxx
        • Description: Where pipe water supplies are existing, steps should be taken to protect the water sources from possible contamination and to promote operation of water works at maximum efficiency. Dosage of chlorine should be increased to provide 0.5 ppm residual chlorine. Temporary extension of pipe supply or distribution of safe water through tankers to the slums and congested, insanitary bustees without pipe supply should be arranged. The piped supply during epidemics must be continuous and under adequate pressure. In rural areas without piped water supplies, chlorination of public as well as of private wells should be organized. Free distribution of bleaching powder should be made available. Methods of chlorination of well waters by catridges or pots have been devised which provide effective chlorine concentration in the wells for more than two weks. Tube-wells should be protected from surface contamination through leaks. Surface water sources, such as ponds and streams, which are easily contaminated, are difficult to protect and should only be used as a last resort after chlorination. People should be allowed to draw water from specified places alongside the bank where arrangement of chlorination has been made. Chlorination of pond water supplies should be done continuously during epidemic. Whatever water sources cannot possibly be rendered safe should be closed or prohibited for use. Sometimes truck-mounted portable water treatment plants or water lorries or trailer tankers are mobilised in emergency to supply safe water. Where safe water sources are not available, the public should be advised to boil water from doubtful sources or treat it with chlorine or iodine tablets before domestic use. Domestic storage and arrangement of taking water from containers should not lead to contamination of stored water (Shrivastav, 1974).
      5. Environmental sanitation: Food sanitation:
        • Ontology: UMLS:xxx
        • Description: In towns, sale of exposed prepared foods and cut fruits sold by itinerant vendors should not be allowed. Strict supervision of sanitation of eating places and hygyiene of food handlers is of importance, as brought out in the classical example of "Temple Street Well". Ice, ice-cream, milk, and bottled water establishments should be especially cared for. In rural areas, people may be encouraged to eat hot food after washing the hands clean. Community feeding, particularly the funeral feasts, which are not an infrequent cause of spread of disease in villages, may be discouraged (Shrivastav, 1974).
      6. Environmental sanitation: Fly control:
        • Ontology: UMLS:xxx
        • Description: Although the role of flies in the transmission of cholera is uncertain, it is generally agreed that a fly control campaign is desirable in control of cholera. The measures should aim at elimination of breeding places rather than the use of insecticides, which have limited value and are expensive. Expeditious collection and disposal of garbage and excreta in urban and rural areas are essential for effective fly control (Shrivastav, 1974).
      7. Environmental sanitation: Disinfection:
        • Ontology: UMLS:xxx
        • Description: Concurrent and terminal disinfection of infective materials of each patient would prevent the spread of vibrios. Patients' stools and vomit should be disinfected before their disposal. Chlorinated lime and Lysol have been found very effective for the purpose. In rural areas, it may be feasible to burn or bury the excretal wastes. Patients' clothes, linen, and utensils should be boiled or dipped in 2% Lysol or chlorinated lime solution. Contaminated floors, furniture, etc., may be scrubbed with either 2% Lysol or chlorinated lime solution (Shrivastav, 1974).
      8. Environmental sanitation: Disposal of dead:
        • Ontology: UMLS:xxx
        • Description: Sanitary disposal of dead patients with due respect to the religious and social customs should be ensured. The disposal of corpses into the rivers, which is practised in some places, is dangerous and should be prohibited (Shrivastav, 1974).

    5. Model System:
      1. Intact dog model:
        1. Ontology: UMLS:xxx
        2. Model Host: Dog
        3. Model Pathogens:
        4. Description: The dog was firmly established as a useful cholera model by Sack and Carpenter and their co-workers between 1966 and 1969. Adult mongrel dogs were found to develop a cholera syndrome following the ingestion of approximately 10(10) viable V. cholerae via stomach tube. The vibrio inoculum, grown in Syncase, was administered with bicarbonate in order to alkalinize stomach contents. Starvation of the dogs was not a prerequisite to successful infection. Following a short incubation period of 6 to 8 hours, the dogs develop vomiting and massive watery diarrhea leading to severe saline depletion, acidosis, and eventually circulatory collapse. If no therapy was given, 90% of the dogs developing this syndrome died, usually within 24 hours, at which time an average of 12% of body weight had been lost in diarrheal fluid. Dogs could be successfully treated, however, by the use of intravenous replacement therapy similar to that used for human cholera. In these dogs, diarrhea lasted for an average of 36 hours, during which time stool losses amounted to about 45% of body weight (Burrows and Sack, 1974).
      2. Mouse:
        1. Ontology: UMLS:xxx
        2. Model Host: Mouse
        3. Model Pathogens:
        4. Description: Infant mice (5-6 days of age) are susceptible to Vibrio cholerae as the developmental state of their intestinal flora and innate immunity permits colonization. The animal model is routinely used to test the efficacy of various cholera anti-sera by passive immunization. Antisera from vaccinated individuals or experimental animals are combined with virulent V. cholerae and gavaged into the stomach of neonatal mice. The mice become moribund or die based on the antisera's ability to protect (Provenzano et al., 2006). Antiserum to the capsular polysaccharide of an opaque variant of Vibrio cholerae O139 strain MDO-12 recognizes capsular antigen in three different colonial variants of the strain, although the amount of recognition varies with the extent of opacity. The anti-capsular-polysaccharide serum, at subagglutinating doses, protected suckling mice against challenge with both the most opaque variant and the most translucent variant. Further studies indicated that the protection was associated with inhibition of intestinal colonization by the vibrios. These results thus highlight the potential importance of the capsule in immunoprophylaxis against cholera caused by V. cholerae O139 (Sengupta et al., 1996).
      3. Mouse:
        1. Ontology: UMLS:xxx
        2. Model Host: Mouse
        3. Model Pathogens:
        4. Description: A sealed adult mouse (SAM) model was developed for studies on the effects of cholera enterotoxin (CT). With this system, 38 strains of outbred, inbred, congenic, recombinant, and mutant mice were starved for 24 h, anorectally occluded with cyanoacrylamide ester glue, given CT per os, and sacrificed at 6 h. Fluid accumulation (FA) values were calculated as gut weight to body weight ratios. At a saturating dose of CT (24 micrograms per mouse), FA responses were found to be independent of body weight and gut length. It was found, using recombinant and congenic mice, that mice which possess the H-2k haplotype (homozygous or heterozygous) are 2.5 to 3 times less responsive to CT than animals with the H-2b haplotype. The allele(s) responsible for this affect is located near the K end of the H-2 complex. Inbred and congenic mice given CT intravenously exhibited the same (b = responder, k = nonresponder) pattern in terms of weight loss and death, thus indicating that the H-2 effect is not limited just to the small intestinal epithelium. Mice given sublethal doses of CT intravenously and challenged after conversion to SAM 14 days later showed an immune response inversely related to weight loss (i.e., b haplotypes lost 10 to 15% body weight, recovered, but were not protected against challenge; k haplotypes lost little or no weight but were protected). To examine the possibility of a cellular basis for control of innate responses to CT, responder C57BL/10 (B10) mice were irradiated with 950 rads and immediately reconstituted with bone marrow from (B10 X B10.BR)F1 (nonresponder) mice. The chimeras became nonresponsive to CT when challenged 5 weeks after reconstitution. Reconstituted B10 controls responded normally. Outbred and inbred nude athymic mice also were nonresponsive when compared with normal responder controls. These data demonstrate a genetic basis for resistance to CT and that response and nonresponse is mediated, at least in part, by cells derived from bone marrow (Richardson and Kuhn, 1986).
      4. Rabbit:
        1. Ontology: UMLS:xxx
        2. Model Host: Rabbit
        3. Model Pathogens:
        4. Description: The most popular intact animal model is the RITARD (removable intestinal tie-adult rabbit diarrhoea) model, which utilizes a temporary slip knot tie of the small bowel that is subsequently removed 2 hours after innoculation of live V. cholerae O1 proximal to the tie. If a sufficiently large innoculum is used, this model allows massive, often fatal, diarrhoea to occur within 1-5 days. The RITARD model has been employed after oral immunization to test the protective capacity of attenuated V. cholerae strains. Successful colonization and immunization of adult rabbits by oral inoculum (usually without diarrhoea) can be accomplished with administration of opium to induce hypoperistalsis (Levine and Kaper, 1996). In an adult rabbit model developed for enteric infection by Vibrio cholerae and enterotoxigenic Escherichia coli, the cecum of each animal was first ligated to prevent it from retaining fluid secreted by the small intestine. A temporary reversible obstruction (a slip knot tie) of the small bowel was introduced at the time of challenge and removed 2 h later. With this modification, a massive and usually fatal cholera-like diarrhea in adult animals challenged with V. cholerae was elicited. Animals challenged with enterotoxigenic E. coli also developed diarrhea which was severe and watery but less explosive and less rapidly fatal than that produced by V. cholerae. The susceptibility of animals in this model to infection by V. cholerae was similar to the susceptibility of infant rabbits challenged intraintestinally. The death rate was almost 25% when 10(3) Vibrio cells were given and 90% or more when the dose was greater than or equal to 10(6) cells per animal (Spira et al., 1981).
      5. Rabbit:
        1. Ontology: UMLS:xxx
        2. Model Host: Rabbit
        3. Model Pathogens:
        4. Description: DISC is a modified RITARD rabbit model. DISC comprises a permanent ligation of the cecum (C) to prevent resorption of the fluid secreted by the small intestine, a temporary ligation of the small intestine (S) to enable the bacteria to colonize, and duodenal inoculation (DI) of the challenge material. The main difference between RITARD and DISC is that in the latter model the challenge material is injected into the duodenum approximately 10 cm distal to the stomach instead of into the jejunum. Four out of 5 V. cholerae strains tested, including 2 serotypes and 2 biotypes, were able to elicit a massive and usually fatal cholera-like diarrhea. The virulence depended strongly on the culturing conditions. One strain, C5, caused fatal diarrhea in a dose of about 1000 organisms, even if the temporary ligation was omitted (DIC model). Other modifications were the DIS and the DI model in which the permanent ligature of the cecum or both ligatures were omitted. Duodenal inoculation of organisms in a dose of 100 X the minimum infective dose (MID) in the DIS or DI model did not cause any disease symptom. However, such inoculations were found to cause protection against subsequent challenges with 100 X MID of homologous and heterologous organisms up to 52 weeks after duodenal inoculation. Subcutaneous injection with classical, whole cell cholera vaccine gave only partial protection of short duration (Guinee et al., 1985).
      6. Rabbit:
        1. Ontology: UMLS:xxx
        2. Model Host: Rabbit
        3. Model Pathogens:
        4. Description: A modified removable intestinal tie adult rabbit diarrhea (RITARD) model was used to investigate the intestinal pathology, intestinal bacterial colonization, intestinal fluid volume, and onset of diarrhea caused by non-O1 Vibrio cholerae. Three strains of non-O1 V. cholerae were studied. RITARD rabbits challenged with 10(3) CFU of strain NRT36S (a strain previously shown to cause diarrhea in volunteers) developed grade 3 diarrhea at 48 to 72 h. Histologic examination showed necrosis of the luminal epithelium in the colon and mild inflammatory cell infiltration in the adjacent lamina propria. The severity and extent of intestinal damage by strain NRT36S was dose dependent. Higher doses of strain NRT36S caused severe necrotizing colitis and enteritis, with bacteremia and mortality at less than 24 h in RITARD rabbits challenged with 10(9) CFU and at less than 48 h in RITARD rabbits challenged with 10(4) CFU. Electron and light microscopy demonstrated invasion of NRT36S into the luminal epithelial cells of the intestine. Challenge of RITARD rabbits with non-O1 V. cholerae A-5 and 2076-79 (strains which did not cause diarrhea in volunteers) did not cause diarrhea or intestinal pathology. Intestinal colonization was transient: at 72 h post challenge, animals inoculated with strain A-5 were culture negative, while only low numbers of strain 2076-79 were detectable (approximately 0.4 to 0.8 CFU/g) (Russell et al., 1992).
  2. Non human host:
    1. Taxonomy Information:
      1. Species:
        1. Non human host :
          • Ontology: UMLS:xxx
          • Scientific Name: Non human host (author et al., 2007)
          • Description: Vibrio cholerae species are widely distributed in aquatic environments, and cholera outbreaks are associated with contaminated food and water supplies. The seasonality of cholera has been associated with physical and biological factors; however, many factors affect the survival of V. cholerae in aquatic environments, for example attachment to plankton, entering into and resuscitation from a viable but nonculturable (VBNC) state, and losses to predators. The probability of being infected with cholera depends on the concentration of V. cholerae in the consumed water. Vibrio cholerae species require a high infectious dose, namely about 10(8) - 10(9) cells, to cause severe cholera in healthy volunteers, and therefore the bacteria need a biological reservoir in which to grow to high concentrations in water in order to infect humans. The ability to find aquatic reservoirs of V. cholerae is an important factor in the epidemiology of cholera. Acanthamoeba species, as well as pathogenic bacteria such as V. cholerae, are present in aquatic environments, including drinking water and these free-living amoebae may play an important role as reservoirs, vectors, and hosts to pathogenic bacteria (author et al., 2007).
          • Variant(s):
            • Chironomoidea :
              • GenBank Taxonomy No.: 41828
              • Scientific Name: Chironomoidea (NCBI Taxonomy)
              • Common Name: Midges (NCBI Taxonomy)
              • Description: Broza and co-workers presented evidence that flying, non-biting midges (Diptera; Chironomidae), collected in the air, carry viable non-O1 non-O139 serogroups of V. cholerae. The association of V. cholerae with chironomid egg masses, which serve as a V. cholerae reservoir, was further confirmed. The transfer of environmental V. cholerae by adult midges from the aquatic environment into bacteria-free water-pools has been recorded in the field. The finding show that aerial transfer by flying chironomids may play a role in the dissemination of V. cholerae in nature (Broza et al., 2005).
            • Crassostrea virginica :
              • GenBank Taxonomy No.: 6565
              • Scientific Name: Crassostrea virginica (NCBI Taxonomy)
              • Common Name: Oyster, eastern oyster (NCBI Taxonomy)
              • Description: The toxigenic Latin American strain of V. cholerae was isolated from Gulf Coast oysters during the summers of 1991 and 1992 (Alexander et al., 1998).
            • Anabaena variabilis :
              • GenBank Taxonomy No.: 1172
              • Scientific Name: Anabaena variabilis (NCBI Taxonomy)
              • Common Name: Blue-green algae (NCBI Taxonomy)
              • Description: Environmental V. cholerae has been detected in association with zooplankton and phytoplankton from the various aquatic environments of Bangladesh. It has been suggested that the enhanced survival of microorganisms in aquatic environments is due to the association with some living surfaces where they find nutrients and a favorable microenvironment. Islam et al. demonstrated that a bluegreen alga (cyanobacterium), Anabaena sp., can provide a microenvironment for protracted survival of V. cholerae O1 in both the microcosm and the aquatic environment of Bangladesh (Islam et al., 2002).
            • Acanthamoeba castellanii :
              • GenBank Taxonomy No.: 5755
              • Scientific Name: Acanthamoeba castellanii (NCBI Taxonomy)
              • Common Name: Aquatic free-living amoeba (author et al., 2007)
              • Description: Vibrio cholerae and A. castellanii inhabit aquatic environments, and it has recently been shown that the encapsulated V. cholerae O139 can survive and grow intracellularly in A. castellanii (author et al., 2007).

    2. Infection Process:

      No infection process information is currently available here.

    3. Disease Information:

      No disease information is currently available here.

    4. Prevention:

      No prevention information is currently available here.

    5. Model System:

      No model system information is currently available here.


IV. Labwork Information

A. Biosafety Information:
  1. General biosafety information :
    • Biosafety Level: Biosafety level 2 practices (Material Safety Date Sheet - Infectious Substances)
    • Applicable: Biosafety level 2 practices, containment equipment and facilities for activities with cultures or potentially infectious clinical materials; animal biosafety level 2 practices and facilities for activities with infected animals (Material Safety Date Sheet - Infectious Substances).
    • Precautions:
    • Disposal:
      • (1) Spills: Allow aerosols to settle; wear protective clothing; gently cover spill with paper towels and apply 1% sodium hypochlorite, starting at perimeter and working towards the centre; allow sufficient contact time (30 min) before clean up. (2) Disposal: Decontaminate before disposal; steam sterilization, chemical disinfection. (3) Storage: In sealed containers that are appropriately identified (Material Safety Date Sheet - Infectious Substances).
B. Culturing Information:
  1. Alkaline Peptone Water :
    1. Description: In many specimens, the concentration of V. cholerae is so high (10(7) - 10(8) per ml of liquid feces) that enrichment is unnecessary. However, enrichment broth is commonly used to recover low levels of vibrios, particularly from formed stools. Alkaline peptone water is the most commonly used enrichment broth; the pH of this medium can range from 8.4 up to 9.2, thus taking advantage of the ability of V. cholerae to multiply at alkaline pH. Enrichment lasts for only 6 to 8 h, as incubation in alkaline peptone water for longer than 8 h may result in overgrowth of other organisms. Less commonly used enrichment media include alkaline peptone water with tellurite, Monsur's tellurite taurocholate broth, and sodium gelatin phosphate broth (Kaper et al., 1995).

    2. Medium:
      1. Alkaline peptone water (APW): Peptone, 10.0 g; NaCl, 10.0 g; distilled water, 1,000 ml. pH has to be adjusted to 8.5 with I N NaOH. Autoclave at 121 C for 10 min (Gomez-Gil and Roque, 2006).
    3. Optimal Temperature: 35-36 C (Gomez-Gil and Roque, 2006) 37 C (Nair et al., 1988)
    4. Optimal pH: 8.6 (Nair et al., 1988)
    5. Upper pH: 9.2 (Kaper et al., 1995)
    6. Lower pH: 8.4 (Kaper et al., 1995)
    7. Note: Alkaline peptone water (APW) is the preferred enrichment medium for vibrios, especially devised for V. cholerae but also for V. parahaemolyticus and other species. The high pH of the medium (pH close to 9) and NaCl concentration inhibit many other bacteria and favor vibrios. Peptone water concentration can range from 1 and 2%, with the later being more appropriate for marine species (Gomez-Gil and Roque, 2006).
  2. Thiosulfate citrate bile salts sucrose(TCBS) agar :
    1. Description: The most commonly used plating medium for V. cholerae is thiosulfate-citrate-bile salts-sucrose (TCBS) agar, which is available from several commercial sources. The sucrose-fermenting V. cholerae isolates are readily detected on this medium as large, yellow, smooth colonies (Kaper et al., 1995).

    2. Medium:
      1. Thiosulfate-citrate-bile salts-sucrose (TCBS) agar (Kaper et al., 1995)
    3. Optimal Temperature: 35 C (Kaper et al., 1995) 37 C (Nair et al., 1988)
    4. Optimal pH: 8.6 (Gomez-Gil and Roque, 2006)
  3. Sucrose teepol tellurite (STT) :
    1. Description: Sucrose teepol tellurite (STT) agar is a more successful medium in positive-recognition palting procedures than thiosulfate-citrate-bile salts-sucrose (TCBS) agar because STT agar yields higher isolation of typical colonies of Vibrio cholerae, which directly agglutinate in antiserum to V. cholerae, from patients and contacts infected with this organism. STT agar has a simple composition and, like TCBS agar, needs no sterilization. STT agar is highly selective for V. cholerae, nonagglutinating vibrios, and Vibrio parahaemolyticus (Chatterjee et al., 1977).

    2. Medium:
      1. Sucrose teepol tellurite (STT) (Gomez-Gil and Roque, 2006)
    3. Optimal pH: 8.0 (Gomez-Gil and Roque, 2006)
    4. Note: Sucrose teepol tellurite is a modification of TCBS whereby the bile salts are replaced with teepol. Bile salts are responsible for variation in the quality of TCBS, a problem commonly associated with this medium; Sucrose teepol tellurite does not contain NaCl, thus favoring V. cholerae, which permitted the growth of more El Tor colonies than TCBS (Gomez-Gil and Roque, 2006).
  4. Cellobiose-Polymyxin B-Colistin agar :
    1. Description: Cellobiose-polymyxin B-colistin agar demonstrated a significant advantage over other media designed for the isolation or differentiation of vibrios: of both the 136 strains representing 19 Vibrio species and the marine isolates of the genera Pseudomonas, Flavobacterium, and Photobacterium, only V. vulnificus and V. cholerae were able to grow. Furthermore, the fermentation of cellobiose by V. vulnificus allowed for the easy differentiation of these two species. This medium offers significant potential as a selective and differential medium for these two pathogenic vibrios (Massad and Oliver, 1987).

    2. Medium:
      1. cellobiose-polymyxin B-colistin agar (Massad and Oliver, 1987)
    3. Optimal pH: 7.6 (Gomez-Gil and Roque, 2006)
  5. Polymyxin-mannose-tellurite (PMT) agar :
    1. Description: A selective and differential agar medium, polymyxin-mannose-tellurite (PMT) agar was devised to differentiate easily colonies of Vibrio cholerae O1 from those of V. cholerae non-O1. The differentiation between colonies of the two vibrios is based on mannose-fermentation. Colonies of V. cholerae O1 on the agar are agglutinated with O1 antiserum of V. cholerae much more easily than those on thiosulfate-citrate-bile salts-sucrose (TCBS) agar (Shimada et al., 1990).

    2. Medium:
      1. The formula of polymyxin-mannose-tellurite (PMP) agar (Shimada et al., 1990)
    3. Optimal pH: 8.4 (Gomez-Gil and Roque, 2006)
  6. Taurocholate tellurite gelatin agar (TTGA) :
    1. Description: Taurocholate tellurite gelatin agar (TTGA) is an inexpensive medium that produces transparent gray colonies (2 to 3 mm in diameter) of V. cholerae with surrounding halo; the colonies are difficult to differentiate from those of V. parahaemolyticus. To overcome this problem, a modified taurocholate tellurite gelatin agar was developed with the addition of beta-galactosidase (4-methyllumbelliferyl-beta-delta-galactosidase); V. cholerae produces a very strong reaction in 24 h or less, showing brilliant-blue fluorescence (Gomez-Gil and Roque, 2006).

    2. Medium:
      1. Taurocholate tellurite agar (Gomez-Gil and Roque, 2006)
    3. Optimal pH: 8.4 (Gomez-Gil and Roque, 2006)
C. Diagnostic Tests :
  1. Organism Detection Tests:
    1. Dark-field or Phase-contrast microscopy:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: Examination of cholera stools by dark-field or phase-contrast microscopy often shows the highly motile vibrios darting through the field, particularly when the concentrations of vibrios are > 10(5) per ml of stool (Kaper et al., 1995). Benenson et al. developed a method for the diagnosis of cholera cases in about 5 minutes by using a dark-field microscopy to look for characteristic motility (shooting stars) of V. cholerae in cholera stool, which could be inhibited by the addition of a specific antisera. The causative serotype was correctly diagnosed in 2 to 5 minutes by direct dark-field microscopic examination of liquid cholera stool in 49.5% of the cases, and after overnight enrichment of stool in 84.8% of cases. A portable dark-field microscope can be used in the field or by the bedside, and no special skill is required. The antisera used must not contain any antiseptic as a preservative. The presence of about 10(5) vibrios per ml seems to be necessary for recognition by this method. The dark-field microscopy and fluorescent antibody techniques are definite advances towards the rapid diagnosis of cholera and may have their uses in specific situations. However, proper isolation and identification of V. cholerae by routine bacteriological methods should follow such procedures which they can only supplement and cannot replace (Barua, 1974). Dark field and phase contrast microscopy have been used to screen liquid or rice-water fecal specimens for V. cholerae. Liquid stool or enrichment broth is examined for the presence of organisms with a darting or "shooting star" motility. If the addition of V. cholerae O1 antiserum results in the cessation of motility, a presumptive identification of V. cholerae is made. NOTE: In nonepidemic settings microscopy should not be used to ruled out Vibrio infections. The pleomorphic microscopic morphology of vibrios renders microscopy unreliable except for determining the Gram stain reaction of this group of organisms (Tison, 1999).
    2. Solid media for the detection of V. cholerae:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: It is also possible to obtain bacteriological diagnosis of cholera within 4 to 5 hours of receipt of a stool specimen by applying the oblique-light technique with a stereoscope. The fecal matter is streaked directly on a pre-dried, non-inhibitory nutrient agar plate (pH 8.6) and incubated for 4 to 5 hours at 37 C. The growth of V. cholerae can be spotted by this technique, particularly in the heavily streaked areas, and picked up for confirmation by the slide-agglutination test with specific antisera. The procedure has been tried with almost total success on more than 300 specimens collected within the first two days of disease before the administration of antimicrobials. Lankford and Burrows also observed such growth after 4 to 6 hours' incubation (Barua, 1974).

  2. Immunoassay Tests:
    1. Direct Fluorescent Antibody (DFA):
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: An improved fluorescent monoclonal antibody staining kit, Cholera DFA, for direct detection and enumeration of Vibrio cholerae O1 has been developed, employing a highly specific anti-A antigen monoclonal antibody, COLTA, labeled with fluorescein isothiocyanate (FITC). An optimized quantity of anti-photobleaching agent is used in a glycerol mounting medium to retard the rapid fading of immunofluorescent stained cells during fluorescent microscopy, thus enabling prolonged inspection of individual fields, as well as improved photographic recording of results without loss of fluorescence intensity. When tested for specificity, all 30 strains of V. cholerae O1 reacted with Cholera DFA, whereas 100 heterologous species examined did not, yielding 100% specificity for all strains examined in this study. A field trial was conducted in Bangladesh, employing Cholera DFA and the results were compared with those obtained by conventional culture methods. Of 44 diarrheal stool specimens tested, Cholera DFA was positive for V. cholerae O1 in all culture-positive stool specimens and negative for all culture-negative stool specimens. The procedure is sensitive and highly specific, as well as simple, i.e., less complex than the indirect fluorescent assay, requiring only one reagent and less than 30 min to complete the staining process, while retarding rapid fading that often occurs with fluorescent microscopy (Hasan et al., 1994(b)).
    2. Coagglutination Test:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: Rapid diagnosis of V. cholerae O1 has been achieved by coagglutination tests utilizing antibodies against the O1 CT B-subunit antigens (Kaper et al., 1995). The coagglutination procedure for detecting Vibrio cholerae was applied directly to 125 watery fecal samples received in the laboratory for bacteriological culture: many of these were from suspected cases of cholera. Of 47 bacteriologically proved cases of cholera, 44 (93.6%) gave positive results by the coagglutination method. There was a good correlation between the coagglutination method, dark-field microscopy, and culture (Jesudason et al., 1984).
    3. Agglutination Test:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A rapid test to identify Vibrio cholerae in stools has been developed. The test depends on the ability of the vibrios to multiply in a specially designed medium in the presence of other intestinal bacteria and to agglutinate against specific antisera directly. The culture medium consisted of 2 parts: agar and broth. Aseptic condition was not required. A 0.5 ml amount of a diluted stool suspension was added to an equal volume of molten agar in freeze drying glass ampules and left to set while 0.3 ml of broth was allowed to run down the ampule slowly to cover the agar surface. The ampule was incubated at 37 degrees C without shaking for 2 to 4 hours or until a slight turbidity of bacterial growth became visible. A drop of V. cholerae antiserum was then added and left to react at room temperature. In a cholera stool, agglutination appeared as a suspension of fine particles within 1 hour. In view of the simple technique, low cost, and easy preparation, the test can be performed in a laboratory with minimal facilities (Lam, 1983).
    4. Antibody Detection Test:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: Antibody tests are particularly useful for the diagnosis of suspected cases of V. cholerae disease which were not confirmed by culture (Tison, 1999). Serological assays have been very useful in retrospectively diagnosing cholera infections. Due to high background levels of immunity in areas where cholera is endemic, the interpretation of antibody titers differs between cholera-endemic and non-cholera-endemic areas. The great majority of individuals develop both vibriocidal and antitoxic immune responses after infection with V. cholerae O1, and nearly all seroconversions are seen by day 10 postchallenge. Seroconversions occurred less often in volunteers with inapparent infection than in individuals with diarrhea. For individuals in countries where cholera is not endemic, levels of vibriocidal antibodies return to baseline in 1 to 6 months after infection, while antitoxin titers diminish in 1 to 2 years but do not return to baseline. Because of elevated vibriocidal antibody levels seen in some individuals even in non-choleraendemic countries, the use of paired acute- and convalescent phase sera is more helpful than a single serum sample. Even with a single serum sample from a patient in an area where cholera is not endemic, an antitoxin level by immunoglobulin G (IgG) ELISA of fourfold or greater than the negative control serum and a titer of vibriocidal antibody greater or equal to 1,280 are strong evidence for a recent infection with V. cholerae O1. Addition of specific polyclonal or monoclonal antibodies directed against the O1 antigen can result in inhibition of motility, thereby identifying V. cholerae O1 in 2 to 5 min in about 50% of the cases. While this technique can be very valuable in areas of cholera endemicity, the sensitivity and specificity of the assay are highly dependent on the skill of the technician performing the test (Kaper et al., 1995).
    5. CholeraScreen:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A rapid and simple test kit (CholeraScreen) for the detection of V. cholerae O1 is a monoclonal antibody based, co-agglutination test and is used directly with stool specimens. It does not include culturing the specimen and is performed without the need for sophisticated laboratory equipment. Specificity of the test was demonstrated, using 118 reference cultures, to which cross-reactions were not observed. Preliminary results of field trials carried out in Guatemala and Bangladesh demonstrated that the test is equally sensitive as conventional culture methods in detecting V. cholerae and, in many cases, more sensitive. The CholeraScreen test is simple, specific, and does not require culturing procedures, making it suitable for direct detection of cells of V. cholerae in clinical specimens, even in the field. Also, the test requires less than five minutes to complete (Colwell et al., 1992).
    6. Dot-blot ELISA:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A "cholera diagnostic kit" was developed for sensitive, specific, rapid, and inexpensive detection of Vibrio cholerae O1. The monoclonal antibody specific to antigen A of Vibrio cholerae O1 was used as an antigen detection reagent and the principle of dot-blot ELISA was adopted. The kits were used in seven Regional Medical Sciences Centres, located at various regions of Thailand where diarrhea occurs frequently. Diagnostic efficiency of the kits in the detection of Vibrio cholerae O1 from rectal swabs of diarrheic patients and their household contacts was evaluated in comparison with the conventional culture method. The two methods were found to have excellent degree of agreement (kappa values > 95%). The dot-blot ELISA has several advantages over the culture methods, ie rapid (dot-blot ELISA takes 1-2 hours while the culture method takes at least two days) and inexpensive. It requires no sophisticated equipment. The procedure is not complicated thus it is easy to train personnel (Supawat et al., 1994).
    7. Enzyme-labeled oligonucleotide probe (ELONP) hybridization:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: Two cholera cases were diagnosed using an enzyme-labeled oligonucleotide probe (ELONP) hybridization test for detection of cholera toxin gene (ctx) in a clinical laboratory at Osaka Airport Quarantine Station. The ELONP test with suspicious colonies of Vibrio cholerae O1 grown on TCBS or Vibrio agar plates gave positive result for ctx within 3 hr. We also tried to apply the ELONP test for direct detection of ctx in their stool and their non-selective culture. Specimens from Case #1, which contained 5.9 x 10(5) CFU/g of V. cholerae O1 in the stool, cultured for 7-8 hr or longer in alkaline peptone water or Marine broth at 37 C, became positive for ctx. On the other hand, specimens from Case #2, which contained 8.7 x 10(8) CFU/ml (of V. cholerae O1 in the stool), gave positive result in this stool itself without any further culture. These data suggest that the ELONP test provides successfully a more rapid and accurate means of identifying "toxigenic" V. cholerae O1 in a clinical laboratory (Miyagi et al., 1994).
    8. Bengal SMART test:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A monoclonal antibody-based test, Bengal SMART, was developed for rapid detection of Vibrio cholerae O139 synonym Bengal directly from stool specimens. The test, which takes about 15 min to complete, was used to screen 189 diarrheal stool specimens. The results were compared with those of a monoclonal antibody-based coagglutination test (COAT) and the conventional culture methods used as the "gold standard" for detection of V. cholerae O139. The Bengal SMART test showed a sensitivity of 100% and a specificity of 97% in comparison with the gold standard. It also fared better than COAT, which had a sensitivity of 96% for rapid detection of V. cholerae O139 synonym Bengal. These results show that Bengal SMART is suitable for use in field settings for rapid diagnosis of cholera caused by V. cholerae O139 (Qadri et al., 1995).
    9. Coagglutination test:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A coagglutination test was developed for identifying suspected colonies of Vibrio cholerae serotype O1 directly from primary isolation plates. Visible agglutination occurs when V. cholerae O1 antibody attached to cell-wall protein A of Staphylococcus aureus reacts with its homologous antigen. From 314 fecal samples from clinically suspected cases of cholera, 210 colonies from thiosulphate citrate bile salts sucrose (TCBS) agar and 222 colonies from taurocholate tellurite gelatin (TTG) agar were tested as suspect V. cholerae. In each case 204 isolates were identified as V. cholerae O1 by conventional methods and also gave positive results for V. cholerae O1 in the coagglutination test; with one partial exception, no other colonies tested gave positive results. The coagglutination test is simple and inexpensive and provides a result 24 h earlier than conventional methods (Rahman et al., 1989).
    10. Cholera SMART:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A further modification of the CholeraScreen kit is the Cholera SMART kit, is a colloidal gold-based colorimetric immunoassay (Kaper et al., 1995). Hasan and co-workers reported the development and testing of a novel, rapid, colorimetric immunodiagnostic kit, Cholera SMART, for direct detection of the presence of Vibrio cholerae O1 in clinical specimens (Hasan et al., 1994(a)). The O1 antigen present in a specimen is captured and concentrated on a solid-phase matrix and appears to the naked eye as a pink-to-red spot resulting from the deposition of colloidal gold (Kaper et al., 1995). Unlike conventional culture methods requiring several days to complete, the Cholera SMART kit can be used directly in the field by untrained or minimally skilled personnel to detect V. cholerae O1 in less than 15 min, without cumbersome laboratory equipment. A total of 120 clinical and environmental bacterial strains, including both O1 and non-O1 serotypes of V. cholerae isolated from samples collected from a variety of geographical regions, were tested, and positive reactions were observed only with V. cholerae O1. Also, results of a field trial in Bangladesh, employing Cholera SMART, showed 100% specificity and 96% sensitivity compared with conventional culture methods. Another field trial, in Mexico, showed that Cholera SMART was 100% in agreement with a recently described coagglutination test when 108 stool specimens were tested (Hasan et al., 1994(a)).
    11. Bengal Direct Fluorescent-Antibody (DFA) test:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: The development and testing of two monoclonal antibody-based rapid immunodiagnostic test kits, BengalScreen, a coagglutination test, and Bengal DFA, a direct fluorescent-antibody test, for direct detection of Vibrio cholerae O139 synonym Bengal in clinical and environmental specimens was reported. The BengalScreen test requires less than 5 min to complete and can be used in the field. Bengal DFA, being more sensitive than BengalScreen, requires only one reagent and less than 20 min for detection and enumeration of V. cholerae O139 synonym Bengal. In tests for specificity, all 40 strains of V. cholerae O139 reacted with both test kits, whereas 157 strains of heterologous species examined did not, yielding 100% specificity in this study. A field trial was conducted in with both BengalScreen and Bengal DFA, and the results were compared with those obtained by conventional culture methods. BengalScreen demonstrated a sensitivity of 95%, a specificity of 100%, a positive predictive value of 100%, and a negative predictive value of 94%. Results obtained by Bengal DFA, on the other hand, were 100% sensitive and 100% specific and yielded 100% positive and negative predictive values compared with culture methods. In a second evaluation, 93 stool specimens from Mexico that were negative for V. cholerae O139 by culture were also tested with both the BengalScreen and Bengal DFA kits. None of the 93 specimens were positive for V. cholerae O139 by both tests (Hasan et al., 1995).
    12. Enzyme-Linked Immunosorbent Assay (ELISA:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A highly sensitive bead enzyme-linked immunosorbent assay (bead ELISA) for detection of cholera toxin (CT) was evaluated for direct detection of CT from stool specimens of patients with acute secretory diarrhea. Of the 75 stool samples examined, 59 yielded biochemically, and serologically confirmed strains of Vibrio cholerae O1. The bead ELISA was positive for CT in stool supernatants in 50 (84.7%) of the 59 samples from which V. cholerae O1 was isolated. In addition, the bead ELISA was positive for three stool specimens which were negative by culture. The free CT present in 48 of the 50 stool samples positive by culture for V. cholerae O1 and for CT by bead ELISA was completely absorbed by anti-CT immunoglobulin G. All of the 59 strains of V. cholerae O1 biotype eltor isolated in this study produced in vitro CT. The concentration of CT present in the bead ELISA-positive stool samples ranged between 26 pg/ml and greater than 100 ng/ml. This bead ELISA is a sensitive and simple method for direct detection of CT in nonsterile stool samples. Ramamurthy and co-workers recommended the routine use of this assay for detection of CT in stool samples and culture supernatants in clinical and reference laboratories (Ramamurthy et al., 1992).
    13. Dipstick Detection Kit:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A recently developed dipsticks for the rapid detection of Vibrio cholerae serotypes O1 and O139 from rectal swabs of hospitalized diarrheal patients after enrichment for 4 h in alkaline peptone water was evaluated. The sensitivity and specificity of the dipsticks were above 92 and 91%, respectively. The dipsticks represent the first rapid test which has been successfully used to diagnose cholera from rectal swabs (Bhuiyan et al., 2003).
    14. Coagglutination (CoA) test:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: The conventional culture method with the coagglutination (CoA) test for detecting V. cholerae O139 antigen in a 4 h fecal enrichment culture was compared. The CoA test reacted positively in all 13 culture positive stool specimens from patients with clinical cholera and negatively in all 23 culture negative specimens from non-diarrhoeal healthy controls. The test also did not show cross reaction with V. cholerae O1 antigen or with any of the enterobacterial antigens of the coliforms. The CoA test was found to be technically simple, rapid and reliable in diagnosing V. cholerae 0139 infection (Agarwal et al., 1995). In another study, the coagglutination test for the rapid diagnosis of cholera was evaluated in comparison with the conventional culture method. A total of 553 stool specimens were processed from cases of acute gastro-enteritis. The sensitivity and specificity of coagglutination test was 92.77% and 95.65% respectively. The coagglutination test is found to be simple, reliable and rapid method for the diagnosis of cholera (Hanumanthappa and Rajagopal, 2001).
    15. dot-blot-ELISA:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: Hybridomas secreting specific monoclonal antibodies (MAbs) to Vibrio cholerae serogroup O139 were produced. Six monoclones (hybridomas) secreting MAbs specific only to lipopolysaccharide of V. cholerae O139 strains and which did not cross-react to 137 strains of other enteric microorganisms were obtained. These clones were designated 12F5-G11, 12F5-G2, 15F5-H5, 5B9-F8, 14C9-D2, and 6D2-D8. The immunoglobulin (Ig) heavy chain isotypes secreted by these clones were IgG2b, IgG2b, IgG2b, IgM, IgG2b, and IgG3, respectively. Clone 12F5-G11 was selected for mass production of MAb, which was used as a detection reagent in the antigen detection assay for diagnosis of cholera caused by V. cholerae O139, and this assay was compared to the conventional bacterial isolation method. Five batches of rectal swab cultures in alkaline-peptone water were collected from 6,497 patients with watery diarrhea. These were 6,310 patients admitted to Bamrasnaradura Infectious Diseases Hospital, 16 patients from Krung Thon Hospital, 78 patients from Bangkok Children's Hospital, 19 patients from Karen refugee camps, and 74 Indian patients from the National Institute of Cholera and Enteric Diseases, Calcutta, India. The V. cholerae O139 isolations from the rectal swab cultures and the antigen detection assays (i.e., the MAb-based dot-blot ELISA) were performed by different persons of different laboratories, and the results were revealed after all specimens had been tested. Of the 6,497 samples tested, the dot-blot ELISA correctly identified 42 of 42 V. cholerae O139-positive samples and gave a result of positive for three samples which were culture negative for V. cholerae O139. The diagnostic sensitivity, specificity, and efficacy of the dot-blot ELISA were 100, 99.95, and 99.26%, respectively. The ELISA is easy to perform and relatively inexpensive. It can test multiple samples at a single time, does not require special equipment, and does not produce great quantities of contaminated waste. Most of all, it reduces the diagnostic time from at least 2 days for the bacterial isolation to less than 90 min. The assay is recommended as a rapid screening test of cholera cases caused by V. cholerae O139 (Chaicumpa et al., 1998).

  3. Nucleic Acid Detection Tests: :
    1. PCR:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A PCR primer pair corresponding to a unique chromosomal region of Vibrio cholerae O139 Bengal, that generated an amplicon from only V. cholerae O139 Bengal was used to screen 180 diarrheal stool specimens. All the 67 V. cholerae O139 culture-positive stool specimens were positive by PCR, and the remaining specimens, which contained either other recognized enteric pathogens or no pathogens, were all negative by PCR (Albert et al., 1997).
      4. Primers:
        • O139-1; O139-2 (V. cholerae O139 specific)
          • Forward: O139-1: 5'-GCGTTATAGGTATCATCAAGAGA-3'
          • Reverse: O139-2: 5'-GTCATTATTAAAACTGCTCCATT-3'
          • Product
    2. Multiplex PCR:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A multiplex polymerase chain reaction assay developed for concurrent detection of rfb sequences specific for the O1 and the O139 serogroups of Vibrio cholerae and for ctxA specific sequences, was found to be highly specific and sensitive and was capable of detecting 65 cfu and 200 cfu per assay of V. cholerae O1 and O139, respectively. Evaluation of the multiplex PCR assay using 121 stool samples from patients admitted to the Infectious Diseases Hospital, Calcutta, showed the assay to be 100% sensitive and 95.2% specific when the culture method was taken as the standard. In addition to the 38 PCR positive stool samples, an additional four samples which were negative by culture method but positive by PCR assay belonged to the O139 serogroup. All the 38 stool samples positive for either O1 or O139 serogroup by PCR assay were also positive for the ctxA amplicon indicating that the O1 and O139 V. cholerae strains have the genetic potential of producing cholera toxin (Hoshino et al., 1998).
      4. Primers:
        • O139F2; O139R2 (V. cholerae O139-rfb specific primers)
          • Forward: O139F2: 5'-AGCCTCTTTATTACGGGTGG-3'
          • Reverse: O139R2: 5'-GTCAAACCCGATCGTAAAGG-3'
          • Product
        • O1F2-1; O1R2-1 (V. cholerae O1-rfb specific primers)
          • Forward: O1F2-1: 5'-GTTTCACTGAACAGATGGG-3'
          • Reverse: O1R2-1: 5'-GGTCATCTGTAAGTACAAC-3'
          • Product
        • VCT1; VCT2 ((ctxA) primers)
          • Forward: VCT1: 5'-ACAGAGTGAGFEMSIMTACTTTGACC-3'
          • Reverse: VCT2: 5'-ATACCATCCATATATTTGGGAG-3'
          • Product
    3. Nested PCR:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A direct method to detect Vibrio cholerae in stool samples was developed by using a PCR procedure that did not require a DNA purification step. Dilution (1/100) of stool samples prevented inhibition of the reaction by contaminants, and two consecutive PCRs, the second one with a nested primer, achieved the desired sensitivity. Comparison of the results obtained from stool swab samples processed by the two-step PCR and by an enzyme-linked immunosorbent assay using GM1 as the capture molecule showed that the former is more sensitive and gave positive results even when V. cholerae was not culturable or dead (Varela et al., 1994).
      4. Primers:
        • Pair of primers
          • Forward: External: 5'-GTGGGAATGCTCCAAGATCATCG-3' [1129-1151]
          • Reverse: External: 5'-ATTGCGGCAATCGCATGAGGCGT-3' [1625-1647]
          • Product
        • Pair of primers
          • Forward: Internal: 5'-GTGGGAATGCTCCAAGATCATCG-3' [1129-1151]
          • Reverse: Internal: 5'-GATATGCAATCCTCAGGGTATCC-3' [1558-1580] PCR mixture were withdrawn and used in the second round of amplification with the internal reverse primer (Varela et al., 1994).
          • Product
    4. PCR:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A set of oligonucleotide primers and amplification conditions for the polymerase chain reaction to detect the ctx operon of Vibrio cholerae was reported. The results of this assay on strains of V. cholerae and related organisms were identical with those obtained by the DNA colony hybridization test with the polynucleotide probe. The detection limit of this system was 1 pg of chromosomal DNA or broth culture containing three viable cells. The polymerase chain reaction method could directly detect the ctx operon sequences in rice-water stool samples from patients with cholera (Shirai et al., 1991).
      4. Primers:
        • Pair of primers
          • Forward: 5'-CTCAGACGGGATTTGTTAGGCACG-3' [712-735]
          • Reverse: 3'-GCATTATCCCCGATGTCTCTATCT-5' [990-1013]
          • Product
    5. PCR:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: Inhibitor(s) of the PCR assay for the direct detection of cholera toxin A gene (ctxA) in human feces was removed by centrifugation and the activity of the remaining inhibitors by dilution. Based on these data, a protocol was developed for pre-treatment of stool specimens for PCR assay, and a simple and rapid protocol was constructed for the diagnostic detection of the ctxA genes in stool specimens in combination with single band detection on gel electrophoresis, dot-blot hybridization and enrichment culture. This protocol was applied to clinical specimens and showed that the PCR method gave 100% agreement with established culture methods for the detection of cholera toxin-producing Vibrio cholerae O1. This protocol was considered to be useful because of its simplicity and the rapidity of diagnosis (Miyagi et al., 1999).
      4. Primers:
        • CTP-1; CTP-2
          • Forward: CTP-1:5'-GGTCAAATCATATTGTCTGGTC-3'
          • Reverse: CTP-2: 5'-ACTCATCGATGATCTTGGAGC-3'
          • Product
    6. Real Time PCR:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-hour-to-1-day
      3. Description: A multi-target molecular beacon based real-time NASBA assay for specific detection of Vibrio cholerae has been developed. The genes encoding the cholera toxin (ctxA), the toxin co-regulated pilus (tcpA) (colonization factor), the ctxA toxin regulator (toxR), the haemolysin gene (hlyA) and the 60 kDa chaperonin product (groEL) were selected as target sequences for detection. The beacons for the five different genetic targets were evaluated by serial dilution of RNA from V. cholerae cells. RNase treatment of the nucleic acids eliminated all NASBA amplification, whereas DNase treatment had no effect, showing that RNA, and not DNA, was amplified. The specificity of the assay was investigated by testing several isolates of V. cholerae, other Vibrio species, Bacillus cereus, Salmonella enterica and Escherichia coli strains. The toxR, groEL and hlyA beacons identified all V. cholerae isolates, whereas the ctxA and tcpA beacons identified the O1 toxigenic clinical isolates. The NASBA assay detected 50 CFU/ml of V. cholerae using the general marker groEL, and tcpA that specifically detects toxigenic strains. A correlation between cell viability and NASBA amplification was achieved for the ctxA, toxR and hlyA targets. RNA isolated from different environmental water samples spiked with V. cholerae was specifically detected by NASBA. These results indicate that NASBA can be used in the rapid detection of V. cholerae from various environmental water samples. This method has a strong potential for detecting toxigenic strains when using the tcpA and ctxA markers. The entire assay including RNA extraction and NASBA amplification was completed within three hours (Fykse et al., 2007).
      4. Primers:
        • Haemolysin gene (hlyA): Pvc55-1 hlyA; Pvc56-2 hlyA; cMBvc10-hlyA
          • Forward: Pvc55-1 hlyA: 5'-aattctaatacgactcactataggg(a)AATCTCTTCCGTCCGATCAA(b)-3'
          • Reverse: Pvc56-2 hlyA: 5'-TGATGCTGAAGGTCAAGCAG-3'
          • Real-time-probe: cMBvc10-hlyA: 5'-ccgatc(d)TCAGAAAGGCTTATGGGGTG gatcgg-3'
          • Product
        • Toxin co-regulated pilus gene (tcpA) : Pvc62-1 tcpA; Pvc60-2 tcpA; MBvc11-tcpA
          • Forward: Pvc62-1 tcpA: 5'- aattctaatacgactcactataggg CGCTGAGACCACACCCATA-3'
          • Reverse: Pvc60-2 tcpA: 5'-GAAGAAGTTTGTAAAAGAAGAACACG-3'
          • Real-time-probe: MBvc11-tcpA: 5'-ccgatcAGAAAACCGGTCAAGAGGGTgatcgg-3'
          • Product
        • Cholera toxin gene (ctxA): Pvc64-1 ctxA; Pvc61-2 ctxA; MBvc-12 ctxA
          • Forward: Pvc64-1 ctxA: 5'-aattctaatacgactcactatagggGAAGGTGGGTGCAGTGGCTATAACA-3'
          • Reverse: Pvc61-2 ctxA: 5'-TGATCATGCAAGAGGAACTCA-3'
          • Real-time-probe: MBvc-12 ctxA: 5'-cgaatcTTGTTAGGCACGATGATGGA gatcgg-3'
          • Product
        • 60 kDa chaperonin product gene (groEL): Pvc65-1 groEL; Pvc66-2 groEL; MBvc13-groEL
          • Forward: Pvc65-1 groEL: 5'-aattctaatacgactcactataggg GATGATGTTGCCCACGCTAGA-3'
          • Reverse: Pvc66-2 groEL: 5'-GGTTATCGCTGCGGTAGAAG-3'
          • Real-time-probe: MBvc13-groEL: 5'-ccgatcCTGTCTGTACCTTGTGCCGAgatcgg-3'
          • Product
        • ctxA toxin regulator gene (toxR): Pvc69-1 toxR; Pvc72-2 toxR; MBvc14-toxR
          • Forward: Pvc69-1 toxR: 5'-aattctaatacgactcactataggg CGGAACCGTTTTGACGTATT-3'
          • Reverse: Pvc72-2 toxR: 5'-CTCGCAATGATTTGCATGAC-3'
          • Real-time-probe: MBvc14-toxR: 5'-ccgatcTTAACCCAAGCCATTTCGAC gatcgg-3'
          • Product

  4. Other Types of Diagnostic Tests:
    1. Biochemical Test:
      1. Ontology: UMLS:xxx
      2. Time to Perform: unknown
      3. Description: Like growth of other Vibrio species, that of V. cholerae is stimulated by the addition of 1% NaCl. However, an important distinction from other Vibrio species is the ability of V. cholerae to grow in nutrient broth without added NaCl. V. mimicus can also grow under these conditions but can be readily distinguished from V. cholerae by lack of sucrose fermentation. Some strains of V. mimicus produce cholera enterotoxin and have been associated with sporadic cases of diarrhea. Suspected V. cholerae isolates can be transferred from primary isolation plates to a standard series of biochemical media used for identification of members of the Enterobacteriaceae and Vibrionaceae families. Both conventional tube tests and commercially available enteric identification systems are suitable for identifying this species. Several key characteristics for distinguishing V. cholerae from other species, and complete summary of biochemical tests for V. cholerae is given by Kaper et al 1995. A crucial test for distinguishing V. cholerae from members of the Enterobacteriaceae is the oxidase test; V. cholerae gives a positive test. The use of colonies obtained directly from TCBS agar may give erroneous oxidase results; therefore, yellow colonies from TCBS should be subcultured by heavy inoculation onto a nonselective medium such as blood agar, allowed to grow for 5 to 8 h, and then tested for oxidase (Kaper et al., 1995).
    2. Biochemical Test:
      1. Ontology: UMLS:xxx
      2. Time to Perform: 1-to-2-days
      3. Description: In many developing countries, simpler identification schemes are employed for identification of V. cholerae. One such scheme involves inoculating suspected V. cholerae colonies from the isolation plate into Kligler iron agar (KIA) medium. Cultures yielding an alkaline slant over acid butt with no gas or Hydrogen sulfide are then tested for oxidase activity and reactivity with O1 or O139 antisera, using growth taken from the KIA slant (Kaper et al., 1995).

V. References

A. Journal References:
Acosta et al., 2001: Acosta CJ, Galindo CM, Kimario J, Senkoro K, Urassa H, Casals C, Corachan M, Eseko N, Tanner M, Mshinda H, Lwilla F, Vila J, Alonso PL. Cholera outbreak in southern Tanzania: risk factors and patterns of transmission. Emerg Infect Dis. 2001; 7(3 Suppl): 583 - 587. [PubMed: 11485679].
Agarwal et al., 1995: Agarwal V, Biswas M, Pathak AA, Saoji AM. Rapid detection of Vibrio cholerae 0139 in faecal specimens by coagglutination. Indian J Med Res. 1995; 101: 55 - 56. [PubMed: 7729848].
Alajo et al., 2006: Alajo SO, Nakavuma J, Erume J. Cholera in endemic districts in Uganda during El Nino rains: 2002 - 2003. Afr Health Sci. 2006; 6(2): 93 - 97. [PubMed: 16916299].
Alam et al., 1990: Alam AN, Alam NH, Ahmed T, Sack DA. Randomised double blind trial of single dose doxycycline for treating cholera in adults. BMJ. 1990; 300(6740): 1619 - 1621. [PubMed: 2196962].
Alam et al., 2006: Alam M, Hasan NA, Sadique A, Bhuiyan NA, Ahmed KU, Nusrin S, Nair GB, Siddique AK, Sack RB, Sack DA, Huq A, Colwell RR. Seasonal cholera caused by Vibrio cholerae serogroups O1 and O139 in the coastal aquatic environment of Bangladesh. Appl Environ Microbiol. 2006; 72(6): 4096 - 4104. [PubMed: 16751520].
Albert et al., 1997: Albert MJ, Islam D, Nahar S, Qadri F, Falklind S, Weintraub A. Rapid detection of Vibrio cholerae O139 Bengal from stool specimens by PCR. J Clin Microbiol. 1997; 35(6): 1633 - 1635. [PubMed: 9163504].
Alexander et al., 1998: Alexander D, DePaolab A, Chirtelc S, Young RB. Detection of Vibrio cholerae in oyster (Crassostrea virginica) homogenate based on centrifugal removal of antimicrobial agents. J Microbiol Methods. 1998; 33(3): 237 - 244.
author et al., 2007: Abd H, Saeed A, Weintraub A, Nair GB, Sandstrom G. Vibrio cholerae O1 strains are facultative intracellular bacteria, able to survive and multiply symbiotically inside the aquatic free-living amoeba Acanthamoeba castellanii. FEMS Microbiol Ecol. 2007; 60(1): 33 - 39. [PubMed: 17381524].
Batra et al., 2006: Batra P, Saha A, Vilhekar KY, Chaturvedi P, Mendiratta DK. Vibrio cholerae 01 ogawa (Eltor) diarrhoea at Sevagram. Indian J Pediatr. 2006; 73(6): 543 - 543. [PubMed: 16816524].
Bhuiyan et al., 2003: Bhuiyan NA, Qadri F, Faruque AS, Malek MA, Salam MA, Nato F, Fournier JM, Chanteau S, Sack DA, Balakrish Nair G. Use of dipsticks for rapid diagnosis of cholera caused by Vibrio cholerae O1 and O139 from rectal swabs. J Clin Microbiol. 2003; 41(8): 3939 - 3941. [PubMed: 12904424].
Bik et al., 1995: Bik EM, Bunschoten AE, Gouw RD, Mooi FR. Genesis of the novel epidemic Vibrio cholerae O139 strain: evidence for horizontal transfer of genes involved in polysaccharide synthesis. EMBO J. 1995; 14(2): 209 - 216. [PubMed: 7835331].
Bik et al., 1996: Bik EM, Gouw RD, Mooi FR. DNA fingerprinting of Vibrio cholerae strains with a novel insertion sequence element: a tool to identify epidemic strains. J Clin Microbiol. 1996; 34(6): 1453 - 1461. [PubMed: 8735097].
Broza et al., 2005: Broza M, Gancz H, Halpern M, Kashi Y. Adult non-biting midges: possible windborne carriers of Vibrio cholerae non-O1 non-O139. . Environ Microbiol. 2005; 7(4): 576 - 585. [PubMed: 15816934].
Chaicumpa et al., 1998: Chaicumpa W, Srimanote P, Sakolvaree Y, Kalampaheti T, Chongsa-Nguan M, Tapchaisri P, Eampokalap B, Moolasart P, Nair GB, Echeverria P. Rapid diagnosis of cholera caused by Vibrio cholerae O139. J Clin Microbiol. 1998; 36(12): 3595 - 3600. [PubMed: 9817879].
Chatterjee et al., 1977: Chatterjee BD, De PK, Sen T. Sucrose teepol tellurite agar: a new selective indicator medium for isolation of Vibrio species. J Infect Dis. 1977; 135(4): 654 - 658. [PubMed: 856920].
Chatterjee et al., 1998: Chatterjee S, Mondal AK, Begum NA, Roychoudhury S, Das J. Ordered cloned DNA map of the genome of Vibrio cholerae 569B and localization of genetic markers. J Bacteriol. 1998; 180(4): 901 - 908. [PubMed: 9473045].
Colwell et al., 1992: Colwell RR, Hasan JA, Huq A, Loomis L, Siebeling RJ, Torres M, Galvez S, Islam S, Tamplin MT, Bernstein D. Development and evaluation of a rapid, simple, sensitive, monoclonal antibody-based co-agglutination test for direct detection of Vibrio cholerae 01. FEMS Microbiol Lett. FEMS Microbiol Lett; 76(3): 215 - 219. [PubMed: 1427010].
CWG et al., 1993: Cholera Working Group International Centre for Diarrhoeal Diseases Research, Bangladesh, Albert MJ, Ansaruzzaman M, Bardhan PK, Faruque ASG, Faruque SM, Islam MS, Mahalanabis D, R. B. Sack RB, Salam MA, Siddique AK, Yunus MD, Zaman K. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 1993; 342(8868): 387 - 390. [PubMed: 8101899].
Das and Gupta, 2005: Das2005 S, Gupta S. Diversity of Vibrio cholerae strains isolated in Delhi, India, during 1992-2000. J Health Popul Nutr. 2005; 23(1): 44 - 51. [PubMed: 15884751].
Donovan and van Netten, 1995: Donovan TJ, van Netten P. Culture media for the isolation and enumeration of pathogenic Vibrio species in foods and environmental samples. Int J Food Microbiol. 1995; 26(1): 77 - 91. [PubMed: 7662520].
Durrheim et al., 2001: Durrheim DN, Harris BN, Speare R, Billinghurst K. The use of hospital-based nurses for the surveillance of potential disease outbreaks. Bull World Health Organ. 2001; 79(1): 22 - 27. [PubMed: 11217663].
Faruque et al., 1998: Faruque SM, Albert MJ, Mekalanos JJ. Epidemiology, genetics, and ecology of toxigenic Vibrio cholerae. Microbiol Mol Biol Rev. 1998; 62(4): 1301 - 1314. [PubMed: 9841673].
Focareta et al., 2006: Focareta A, Paton JC, Morona R, Cook J, Paton AW. A recombinant probiotic for treatment and prevention of cholera. Gastroenterology. 2006; 130(6): 1688 - 1695. [PubMed: 16697733].
Fykse et al., 2007: Fykse EM, Skogan G, Davies W, Olsen JS, Blatny JM. Detection of Vibrio cholerae by Real-Time Nucleic Acid Sequence -Based Amplification. Appl Environ Microbiol. 2007; [Epub ahead of print]([Epub ahead of print]): [Epub ahead of print] - [Epub ahead of print]. [PubMed: 17220262].
Garrigue et al., 1986: Garrigue GP, Ndayo M, Sicard JM, Fonkoua MC, Lemao G, Durand JP, Dodin A. [Antibiotic resistance of strains of Vibrio cholerae eltor isolated in Douala (Cameroon)]. Bull Soc Pathol Exot Filiales. 1986; 79(3): 305 - 312. [PubMed: 3769118].
Glass et al., 1991: Glass RI, Claeson M, Blake PA, Waldman RJ, Pierce NF. Cholera in Africa: lessons on transmission and control for Latin America. Lancet. 1991; 338(8770): 791 - 795. [PubMed: 1681168].
Griffith et al., 2006: Griffith DC, Kelly-Hope LA, Miller MA. Review of reported cholera outbreaks worldwide, 1995-2005. Am J Trop Med Hyg. 2006; 75(5): 973 - 977. [PubMed: 17123999].
Guinee et al., 1985: Guinee PA, Jansen WH, Peters PW. Vibrio cholerae infection and acquired immunity in an adult rabbit model. Zentralbl Bakteriol Mikrobiol Hyg [A]. 1985; 259(1): 118 - 131. [PubMed: 4002931].
Guthmann,1995: Guthmann JP. Epidemic cholera in Latin America: spread and routes of transmission. J Trop Med Hyg. 1995; 98(6): 419 - 427. [PubMed: 8544225].
Halpern et al., 2004: Halpern M, Broza YB, Mittler S, Arakawa E, Broza M. Chironomid egg masses as a natural reservoir of Vibrio cholerae non-O1 and non-O139 in freshwater habitats. Microb Ecol. 2004; 47(4): 341 - 349. [PubMed: 14681736].
Hanumanthappa and Rajagopal, 2001: Hanumanthappa AR, Rajagopal V Rapid diagnosis of cholera by coagglutination test. Indian J Pathol Microbiol. 2001; 44(2): 123 - 124. [PubMed: 11883125].
Hasan et al., 1994(a): Hasan JA, Huq A, Tamplin ML, Siebeling RJ, Colwell RR. A novel kit for rapid detection of Vibrio cholerae O1. J Clin Microbiol. 1994; 32(1): 249 - 252. [PubMed: 8126193].
Hasan et al., 1994(b): Hasan JA, Bernstein D, Huq A, Loomis L, Tamplin ML, Colwell RR. Cholera DFA: an improved direct fluorescent monoclonal antibody staining kit for rapid detection and enumeration of Vibrio cholerae O1. FEMS Microbiol Lett. 1994; 120(1-2): 143 - 148. [PubMed: 8056287].
Hasan et al., 1995: Hasan JA, Huq A, Nair GB, Garg S, Mukhopadhyay AK, Loomis L, Bernstein D, Colwell RR. Development and testing of monoclonal antibody-based rapid immunodiagnostic test kits for direct detection of Vibrio cholerae O139 synonym Bengal. J Clin Microbiol. 1995; 33(11): 2935 - 2939. [PubMed: 8576349].
Heidelberg et al., 2000: Heidelberg JF, Eisen JA, Nelson WC, Clayton RA, Gwinn ML, Dodson RJ, Haft DH, Hickey EK, Peterson JD, Umayam L, Gill SR, Nelson KE, Read TD, Tettelin H, Richardson D, Ermolaeva MD, Vamathevan J, Bass S, Qin H, Dragoi I, Sellers P, McDonald L, Utterback T, Fleishmann RD, Nierman WC, White O, Salzberg SL, Smith HO, Colwell RR, Mekalanos JJ, Venter JC, Fraser CM. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature. 2000; 406(6795): 477 - 483. [PubMed: 10952301].
Hoshino et al., 1998: Hoshino K, Yamasaki S, Mukhopadhyay AK, Chakraborty S, Basu A, Bhattacharya SK, Nair GB, Shimada T, Takeda Y. Development and evaluation of a multiplex PCR assay for rapid detection of toxigenic Vibrio cholerae O1 and O139. FEMS Immunol Med Microbiol. 1998; 20(3): 201 - 207. [PubMed: 9566491].
Hossain et al., 2002: Hossain MS, Salam MA, Rabbani GH, Kabir I, Biswas R, Mahalanabis D. Tetracycline in the treatment of severe cholera due to Vibrio cholerae O139 Bengal. J Health Popul Nutr. 2002; 20(1): 18 - 25. [PubMed: 12022154].
Islam et al., 2002: Islam MS, Goldar MM, Morshed MG, Khan MN, Islam MR, Sack RB. Involvement of the hap gene (mucinase) in the survival of Vibrio cholerae O1 in association with the blue-green alga, Anabaena sp. Can J Microbiol. 2002; 48(9): 793 - 800. [PubMed: 12455611].
Jain et al., 2006: Jain V, Dongre M, Raychaudhuri S. Interaction of Vibrio cholerae O139 with an intestinal parasite, Entamoeba histolytica. J Med Microbiol. 2006; 55(Pt12): 1755 - 1756. [PubMed: 17108284].
Jesudason et al., 1984: Jesudason MV, Thangavelu CP, Lalitha MK. Rapid screening of fecal samples for Vibrio cholerae by a coagglutination technique. J Clin Microbiol. 1984; 19(5): 712 - 713. [PubMed: 6736229].
Kaper et al., 1995: Kaper JB, Morris JG Jr, Levine MM. Cholera. Clin Microbiol Rev. 1995; 8(1): 48 - 86. [PubMed: 7704895].
Kaysner et al., 1987: Kaysner CA, Abeyta C Jr, Wekell MM, DePaola A Jr, Stott RF, Leitch JM. Incidence of Vibrio cholerae from estuaries of the United States West Coast. Appl Environ Microbiol. 1987; 53(6): 1344 - 1348. [PubMed: 3606111].
Khan et al., 1996: Khan WA, Bennish ML, Seas C, Khan EH, Ronan A, Dhar U, Busch W, Salam MA. Randomised controlled comparison of single-dose ciprofloxacin and doxycycline for cholera caused by Vibrio cholerae 01 or 0139. Lancet. 1996; 348(9023): 296 - 300. [PubMed: 8709688].
Krishna et al., 2006: Krishna BV, Patil AB, Chandrasekhar MR. Fluoroquinolone-resistant Vibrio cholerae isolated during a cholera outbreak in India. Trans R Soc Trop Med Hyg. 2006; 100(3): 224 - 226. [PubMed: 16246383].
Lam, 1983: Lam SY A rapid test for the identification of Vibrio cholerae in stools. J Diarrhoeal Dis Res. 1983; 1(2): 87 - 89. [PubMed: 6680124].
Larocque et al., 2005: Larocque RC, Harris JB, Dziejman M, Li X, Khan AI, Faruque AS, Faruque SM, Nair GB, Ryan ET, Qadri F, Mekalanos JJ, Calderwood SB. Transcriptional profiling of Vibrio cholerae recovered directly from patient specimens during early and late stages of human infection. Infect Immun. 2005; 73(8): 4488 - 4493. [PubMed: 16040959].
Leyten et al., 2005: Leyten EM, Soonawala D, Schultsz C, Herzog C, Ligthelm RJ, Wijnands S, Visser LG. Analysis of efficacy of CVD 103-HgR live oral cholera vaccine against all-cause travellers' diarrhoea in a randomised, double-blind, placebo-controlled study. Vaccine. 2005; 23(43): 5120 - 5126. [PubMed: 15982790].
Li et al., 2002: Li M, Shimada T, Morris JG Jr, Sulakvelidze A, Sozhamannan S. Evidence for the emergence of non-O1 and non-O139 Vibrio cholerae strains with pathogenic potential by exchange of O-antigen biosynthesis regions. Infect Immun. 2003; 70(5): 2441 - 2453. [PubMed: 11953381].
Massad and Oliver, 1987: Massad G, Oliver JD New selective and differential medium for Vibrio cholerae and Vibrio vulnificus. Appl Environ Microbiol. 1987; 53(9): 2262 - 2264. [PubMed: 3674873].
Matsushita et al., 1997: Matsushita S, Noguchi Y, Yanagawa Y, Igarashi H, Morita K, Wada H, Watanabe N, Shibata M, Kanamori M, Kudoh Y, Shimada T. [Sporadic diarrhea caused by Vibrio cholerae non-O1 and characteristics of the isolates]. Kansenshogaku Zasshi. 1997; 71(12): 1204 - 1209. [PubMed: 9483880].
Miyagi et al., 1994: Miyagi K, Matsumoto Y, Hayashi K, Yoh M, Yamamoto K, Honda T. Successful application of enzyme-labeled oligonucleotide probe for rapid and accurate cholera diagnosis in a clinical laboratory. Microbiol Immunol. 1994; 38(4): 301 - 304. [PubMed: 7935049].
Miyagi et al., 1999: Miyagi K, Sano K, Morita C, Imura S, Morimatsu S, Goto T, Nakano Y, Omura K, Matsumoto Y, Maeda K, Hashimoto S, Honda T. An improved method for detecting faecal Vibrio cholerae by PCR of the toxin A gene. J Med Microbiol. 1999; 48(10): 883 - 889. [PubMed: 10510964].
Mohapatra et al., 2007: Mohapatra SS, Ramachandran D, Mantri CK, Singh DV. Characterization of the genetic background of Vibrio cholerae O1 biotype El Tor serotype Inaba strains isolated in Trivandrum, southern India. J Med Microbiol. 2007; 56(Pt 2): 260 - 265. [PubMed: 17244810].
Moszynski, 2006: Moszynski P Cholera outbreak in Darfur is made worse by advent of rains. BMJ. 2006; 332(7556): 1472 - 1472. [PubMed: 16793806].
Nair et al., 1988: Nair, GB, Sarkar BL, De SP, Chakraborty MK, Bhadra RK, Pal SC. Ecology of Vibrio cholerae in the fresh water environs of Calcutta. Microb Ecol. 1988; 15(2): 203 - 215. [PubMed: ISSN: 0095-3628 (Print) 1432-184X (Online)].
Ndour et al., 2006: Ndour CT, Manga NM, Ka R, Dia-Badiane NM, Fortez L, Seydi M, Soumare M, Sow AI, Diop BM, Sow PS. [Cholera epidemic of 2004 in Dakar, Senegal: epidemiologic, clinical and therapeutic aspects]. Med Trop (Mars). 2006; 66(1): 33 - 38. [PubMed: 16615613].
Nelesone et al., 2006: Nelesone T, Durrheim DN, Speare R, Kiedrzynski T, Melrose WD. Short communication: Strengthening sub-national communicable disease surveillance in a remote Pacific Island country by adapting a successful African outbreak surveillance model. Trop Med Int Health. 2006; 11(1): 17 - 21. [PubMed: 16398751].
Palmer and Colwell, 1991: Palmer LM, Colwell RR. Detection of luciferase gene sequence in nonluminescent Vibrio cholerae by colony hybridization and polymerase chain reaction. Appl Environ Microbiol. 1991; 57(5): 1286 - 1293. [PubMed: 1854193].
Pazzani et al., 2006: Pazzani C, Scrascia M, Dionisi AM, Maimone F, Luzzi I. Molecular epidemiology and origin of cholera reemergence in Italy and Albania in the 1990s. Res Microbiol. 2006; 157(6): 508 - 512. [PubMed: 16797934].
Provenzano et al., 2006: Provenzano D, Kovac P, Wade WF. The ABCs (Antibody, B Cells, and Carbohydrate Epitopes) of Cholera Immunity: Considerations for an Improved Vaccine. Microbiol Immunol. 2006; 50(12): 899 - 927. [PubMed: 17179659].
Pulungsih et al., 2006: Pulungsih SP, Punjabi NH, Rafli K, Rifajati A, Kumala S, Simanjuntak CH, Yuwono, Lesmana M, Subekti D, Sutoto, Fontaine O. Standard WHO-ORS versus reduced-osmolarity ORS in the management of cholera patients. J Health Popul Nutr. 2006; 24(1): 107 - 112. [PubMed: 16796157].
Purdy et al., 2005: Purdy A, Rohwer F, Edwards R, Azam F, Bartlett DH. A glimpse into the expanded genome content of Vibrio cholerae through identification of genes present in environmental strains. J Bacteriol. 2005; 187(9): 2992 - 3001. [PubMed: 15838025].
Qadri et al., 1995: Qadri F, Hasan JA, Hossain J, Chowdhury A, Begum YA, Azim T, Loomis L, Sack RB, Albert MJ. Evaluation of the monoclonal antibody-based kit Bengal SMART for rapid detection of Vibrio cholerae O139 synonym Bengal in stool samples. J Clin Microbiol. 1995; 33(3): 732 - 734. [PubMed: 7751386].
Rahman et al., 1989: Rahman M, Sack DA, Wadood A, Yasmin M, Latif A. Rapid identification of Vibrio cholerae serotype O1 from primary isolation plates by a coagglutination test. J Med Microbiol. 1989; 28(1): 39 - 41. [PubMed: 2913315].
Ramamurthy et al., 1992: Ramamurthy T, Bhattacharya SK, Uesaka Y, Horigome K, Paul M, Sen D, Pal SC, Takeda T, Takeda Y, Nair GB. Evaluation of the bead enzyme-linked immunosorbent assay for detection of cholera toxin directly from stool specimens. J Clin Microbiol. 1992; 30(7): 1783 - 1786. [PubMed: 1629335].
Richardson and Kuhn, 1986: Richardson SH, Kuhn RE. Studies on the genetic and cellular control of sensitivity to enterotoxins in the sealed adult mouse model. Infect Immun. 1986; 54(2): 522 - 528. [PubMed: 3533783].
Rubin et al., 1998: Rubin EJ, Lin W, Mekalanos JJ, Waldor MK. Replication and integration of a Vibrio cholerae cryptic plasmid linked to the CTX prophage. Mol Microbiol. 1998; 28(6): 1247 - 1254. [PubMed: 9680213].
Russell et al., 1992: Russell RG, Tall BD, Morris JG Jr. Non-O1 Vibrio cholerae intestinal pathology and invasion in the removable intestinal tie adult rabbit diarrhea model. Infect Immun. 1992; 60(2): 435 - 442. [PubMed: 1730473].
Ryzhko et al., 2005: Ryzhko IV, Dudina NA, Lomov IuM, Shut'ko AG, Tsuraeva RI, Anisimov BI. [Activity of 22 antibacterials against O1 and O139 serogroup Vibrio cholerae strains isolated from humans within 1927-2005 in various regions of the world]. Antibiot Khimioter. 2005; 50(8-9): 38 - 42. [PubMed: 17016910].
Sack et al., 1978: Sack DA, Islam S, Rabbani H, Islam A. Single-dose doxycycline for cholera. Antimicrob Agents Chemother. 1978; 14(3): 462 - 464. [PubMed: 708024].
Sack et al., 2004: Sack DA, Sack RB, Nair GB, Siddique AK. Cholera. Lancet. 2004; 363(9404): 223 - 233. [PubMed: 14738797].
Sack et al., 2006: Sack DA, Sack RB, Chaignat CL. Getting serious about cholera. N Engl J Med. 2006; 355(7): 649 - 651. [PubMed: 16914700].
Safa et al., 2006: Safa A, Bhuyian NA, Nusrin S, Ansaruzzaman M, Alam M, Hamabata T, Takeda Y, Sack DA, Nair GB. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J Med Microbiol. 2006; 55(Pt 11): 1563 - 1569. [PubMed: 17030917].
Saha et al., 2006: Saha D, Karim MM, Khan WA, Ahmed S, Salam MA, Bennish ML. Single-dose azithromycin for the treatment of cholera in adults. N Engl J Med. 2006; 354(23): 2452 - 2462. [PubMed: 16760445].
Schoolnik and Yildiz, 2000: Schoolnik GK, Yildiz FH. The complete genome sequence of Vibrio cholerae: a tale of two chromosomes and of two lifestyles. Genome Biol. 2000; 1(3): [1016.1] - [1016.3]. [PubMed: 11178241].
Sengupta et al., 1996: Sengupta DK, Boesman-Finkelstein M, Finkelstein RA. Antibody against the capsule of Vibrio cholerae O139 protects against experimental challenge. Infect Immun. 1996; 64(1): 343 - 345. [PubMed: 8557361].
Sharma et al., 1998: Sharma C, Thungapathra M, Ghosh A, Mukhopadhyay AK, Basu A, Mitra R, Basu I, Bhattacharya SK, Shimada T, Ramamurthy T, Takeda T, Yamasaki S, Takeda Y, Nair GB. Molecular analysis of non-O1, non-O139 Vibrio cholerae associated with an unusual upsurge in the incidence of cholera-like disease in Calcutta, India. J Clin Microbiol. 1998; 36(3): 756 - 763. [PubMed: 9508308].
Shimada et al., 1990: Shimada T, Sakazaki R, Fujimura S, Niwano K, Mishina M, Takizawa K. A new selective, differential agar medium for isolation of Vibrio cholerae O1: PMT (polymyxin-mannose-tellurite) agar. Jpn J Med Sci Biol. 1990; 43(2): 37 - 41. [PubMed: 2175000].
Shirai et al., 1991: Shirai H, Nishibuchi M, Ramamurthy T, Bhattacharya SK, Pal SC, Takeda Y. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae. J Clin Microbiol. 1991; 29(11): 2517 - 2521. [PubMed: 1774258].
Siddiqui and Bhattacharyya, 1997: Siddiqui KA, Bhattacharyya FK. Phage-induced change of toxigenesis in Vibrio cholerae. J Med Microbiol. 1997; 23(4): 331 - 334. [PubMed: 3585965].
Singh et al., 2001: Singh DV, Matte MH, Matte GR, Jiang S, Sabeena F, Shukla BN, Sanyal SC, Huq A, Colwell RR. Molecular analysis of Vibrio cholerae O1, O139, non-O1, and non-O139 strains: clonal relationships between clinical and environmental isolates. Appl Environ Microbiol. 2001; 67(2): 910 - 921. [PubMed: 11157262].
Spira et al., 1981: Spira WM, Sack RB, Froehlich JL. Simple adult rabbit model for Vibrio cholerae and enterotoxigenic Escherichia coli diarrhea. Infect Immun. 1981; 32(2): 739 - 747. [PubMed: 7019078].
Supawat et al., 1994: Supawat K, Huttayananont S, Kusum M, Kalambaheti T, Chaicumpa W. A monoclonal antibody-based dot-blot ELISA diagnostic kit for the detection of Vibrio cholerae 01 in stools of diarrheic patients and household contacts. Asian Pac J Allergy Immunol. 1994; 12(2): 155 - 159. [PubMed: 7612110 ].
Tracz et al., 2007: Tracz DM, Backhouse PG, Olson AB, McCrea JK, Walsh JA, Ng LK, Gilmour MW. Rapid detection of Vibrio species using liquid microsphere arrays and real-time PCR targeting the ftsZ locus. J Med Microbiol. 2007; 56(Pt 1): 56 - 65. [PubMed: 17172518].
Varela et al., 1994: Varela P, Pollevick GD, Rivas M, Chinen I, Binsztein N, Frasch AC, Ugalde RA. Direct detection of Vibrio cholerae in stool samples. J Clin Microbiol. 1994; 32(5): 1246 - 1248. [PubMed: 8051251].
von Seidlein, 2006: von Seidlein L Editorial: A small step for WHO, a big step for cholera control. Trop Med Int Health. 2006; 11(12): 1773 - 1774. [PubMed: 17176340].
WHO, 2006: World Health Organization Cholera 2005. Wkly Epidemiol Rec. 2006; 81(31): 297 - 307. [PubMed: 16888873].
Yamamoto et al., 1995: Yamamoto T, Nair GB, Albert MJ, Parodi CC, Takeda Y. Survey of in vitro susceptibilities of Vibrio cholerae O1 and O139 to antimicrobial agents. Antimicrob Agents Chemother. 1995; 39(1): 241 - 244. [PubMed: 7695314].
B. Book References:
AHFS Drug Information, 2006(a): The American Society of Health-System Pharmacists. Azithromycin. 234 - 250. In: McEvoy Gerald K. AHFS Drug Information Handbook 2006. The American Society of Health-System Pharmacists, Inc., Bethesda, MD, USA.
AHFS Drug Information, 2006(b): The American Society of Health-System Pharmacists. Ciprofloxacin. 364 - 385. In: McEvoy Gerald K. AHFS Drug Information Handbook 2006. The American Society of Health-System Pharmacists, Inc., Bethesda, MD, USA.
Barua, 1974: Barua D. Laboratory diagnosis of chlolera. 85 - 126. In: Barua Dhiman, Burrows William. Cholera 1974. W. B. Saunders Complany, Philadelphia . London . Toronto.
Burrows and Sack, 1974: Burrows William, Sack R. Bradley. Animal models of cholera. 189 - 205. In: Barua Dhiman, Burrows William. Cholera 1974. W. B. Saunders Complany, Philadelphia . London . Toronto.
Finkelstein, 1996: Finkelstein Richard A. Chapter 24: Cholera, Vibrio cholerae O1 and O139, and Other Pathogenic Vibrios. - . In: Samuel Baron Medical Microbiology. 4th ed 1996. University of Texas Medical Branch, Galveston, Texas.
Forbes et al., 2002: Forbes Betty A, Sahm Daniel F, Weissfeld Alice S. Vibrio, Aeromonas, Plesiomonas, Shigelloids, and Chromobacterium violaceum. 423 - 433. In: Forbes Betty A, Sahm Daniel F, Weissfeld Alice S. Bailey and Scott's Diagnostic Microbiology, 11th Edition 2002. Mosby, St. Louis . London . Philadelphia . Sydney . Toronto.
Gomez-Gil and Roque, 2006: Gomez-Gil Bruno, Roque Ana. Isolation, Enumeration, and Preservation of the Vibrionaceae. 15 - 26. In: Thompson Fabiano L, Austin Brian, Swings Jean. The Biology of Vibrios 2006. American Society for Microbiology Press, Washington, DC.
Levine and Kaper, 1996: Levine MM, Kaper JB. Chapter 5: Cholera: pathogenesis and vaccine development. 125 - 186. In: Drasar BS, Forrest BD Cholera And The Ecology of Vibrio cholerae1996. Chapman & Hall, London . Weinheim . New York . Tokyo . Melbourne . Madras.
Prouty and Klose, 2006: Prouty Michael G, Klose Karl E. Vibrio cholerae: the genetics of pathogenesis and environmental resistance. 311 - 339. In: Thompson Fabiano L, Austin Brian, Swings Jean. The Biology of Vibrios 2006. American Society for Microbiology Press, Washington, DC.
Seas and Gotuzzo, 2005: Seas Carlos, Gotuzzo Eduardo. Vibrio cholerae. 3607 - 3612. In: Mandell Gerald L, Bennett John E, Dolin Raphael. Principles and Practice of Infectious Diseases, 6th Edition 2005. Churchill Livingstone, New York.
Shrivastav, 1974: Shrivastav JB. Prevention and control of cholera. 405 - 426. In: Barua Dhiman, Burrows William. Cholera 1974. W. B. Saunders Complany, Philadelphia . London . Toronto.
Strohl et al., 2001: Strohl William A, Rouse Harriet, Fisher Bruce D. VI. Vibrios. 185 - 186. In: Harvey Richard A, Champe Pamela C. Lippincott's Illustrated Reviews: Microbiology 2001. Lippincott Williams & Wilkins (A wolters Kluwer Company), Philadelphia . Baltimore . New York . London . Buenos Aires . Hong Kong . Sydney . Tokyo.
Thompson and Swings, 2006: Thompson Fabiano L, Swings Jean. Taxonomy of the Vibrios. 29 - 43. In: Thompson Fabiano L, Austin Brian, Swings Jean. The Biology of Vibrios 2006. American Society for Microbiology Press, Washington, DC.
Tison, 1999: Tison David L. Vibrio. 497 - 506. In: Murray Patrick R. Manual of Clinical Microbiology, 7th Edition 1999. ASM Press, Washington DC, USA.
C. Website References:
Material Safety Date Sheet - Infectious Substances: Vibrio cholerae, serogroup O1, serogoup O139 (Bengal) [ http://www.phac-aspc.gc.ca/msds-ftss/msds164e.html ].
NCBI Taxonomy: Vibrio cholerae [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=666&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae 1587 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=412966&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae 2740-80 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=412614&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae 569B [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=44104&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae AM-19226 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=404974&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae bv. albensis [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=376726&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae MAK 757 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=412967&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae MO10 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=345072&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae MZO-3 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=412883&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae non-O1 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=66861&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae non-O1/non-O139 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=156539&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae O1 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=127906&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae O1 biovar eltor [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=686&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae O1 biovar eltor str. N16961 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=243277&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae O139 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=45888&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae O27 [ Thttp://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=185331&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae O37 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=185332&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae O395 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=345073&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae RC385 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=345074&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae V51 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=345075&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Vibrio cholerae V52 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=345076&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Entrez: Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, complete sequence. [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=161 ].
NCBI Entrez: Vibrio cholerae O1 biovar eltor str. N16961 chromosome II, complete sequence. [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=162 ].
NCBI Entrez: Vibrio cholerae plasmid pSIO1, complete sequence [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=18246 ].
NCBI Entrez: Vibrio cholerae plasmid pTLC, complete sequence. [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genome&cmd=Retrieve&dopt=Overview&list_uids=17257 ].
NCBI Taxonomy: Crassostrea virginica [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=6565 ].
NCBI Taxonomy: Vibrio cholerae 623-39 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=417397&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Genome Project: Vibrio cholerae 623-39 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=18493 ].
NCBI Genome Project: Vibrio cholerae AM-19226 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=17723 ].
NCBI Genome Project: Vibrio cholerae 2740-80 [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=18253 ].
NCBI Genome Project: Vibrio cholerae 1587 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=18265 ].
NCBI Genome Project: Vibrio cholerae B33 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=18499 ].
NCBI Genome Project: Vibrio cholerae MAK 757 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=18263 ].
NCBI Genome Project: Vibrio cholerae MO10 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=15666 ].
NCBI Taxonomy: Vibrio cholerae MZO-2 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=417398&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Genome Project: Vibrio cholerae MZO-2 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=18495 ].
NCBI NCBI Genome Project: Vibrio cholerae MZO-3 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=18261 ].
NCBI Taxonomy: Vibrio cholerae NCTC 8457 [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=417399&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Genome Project: Vibrio cholerae NCTC 8457 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=18497 ].
NCBI Genome Project: Vibrio cholerae O1 biovar eltor str. N16961 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=36 ].
NCBI Genome Project: Vibrio cholerae O395 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=15667 ].
NCBI Genome Project: Vibrio cholerae RC385 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=15668 ].
NCBI Genome Project: Vibrio cholerae V51 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=15669 ].
NCBI Genome Project: Vibrio cholerae V52 project at TIGR [ http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=genomeprj&cmd=Retrieve&dopt=Overview&list_uids=15670 ].
NCBI Taxonomy: Homo sapiens [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Chironomoidea [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=41828&lvl=3&lin=f&keep=1&srchmode=1&unlock ].
NCBI Taxonomy: Acanthamoeba castellanii [ http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=5755 ].
United States Agency for International Development (USAIID): Biological Agent Information Papers: Glossary of Bio-Agents [ http://www.lsic.ucla.edu/classes/mimg/robinson/micro12/Webste_Active/webpages/BioAgents.html ].
WHO - Epidemic and Pandemic Alert and Response (EPR): Cholera in Sudan - update 4 [ http://www.who.int/csr/don/2006_06_21a/en/index.html ].
D. Thesis References:

No thesis or dissertation references used.


VI. Curation Information