Yersinia pestis
I. Organism Information
A. Taxonomy Information
-
Species:
-
Yersinia pestis (Website 22):
-
Ontology: UMLS:C0043408
-
GenBank Taxonomy No.:
632
-
Description:
The causative agent of plague was identified by the Swiss microbiologist Alexandre Yersin who was investigating an 1894 outbreak in Hong Kong. Yersinia pestis has undergone several nomenclature changes - Bacterium pestis until 1900, Bacillus pestis until 1923, Pasteurella pestis (after Yersin's mentor), and finally, Yersinia pestis in 1970 (Perry and Fetherston, 1997).
-
Variant(s):
-
Yersinia pestis, biovar Antiqua (Deng et al., 2002):
-
Description:
Yersinia pestis strains fall into three subtypes or biovars: Antiqua, Mediaevalis, and Orientalis, each of which is associated with a major pandemic (Deng et al., 2002).
-
Yersinia pestis, biovar Mediaevalis (Deng et al., 2002):
-
Description:
Yersinia pestis strains fall into three subtypes or biovars: Antiqua, Mediaevalis, and Orientalis, each of which is associated with a major pandemic (Deng et al., 2002).
-
Yersinia pestis, biovar Orientalis (Deng et al., 2002, Radnedge et al., 2001):
-
Description:
Yersinia pestis strains fall into three subtypes or biovars: Antiqua, Mediaevalis, and Orientalis, each of which is associated with a major pandemic (Deng et al., 2002).
The Orientalis biovar of Yersinia pestis is considered to be the most recently emerged biovar, and it includes all of the strains isolated so far in the United States (Radnedge et al., 2001).
-
Yersinia pestis, KIM strain (Website 23):
-
GenBank Taxonomy No.:
187410
-
Description:
The KIM strain belongs to biovar Mediaevalis and its genome has been sequenced (Deng et al., 2002).
-
Yersinia pestis, CO92 strain:
-
GenBank Taxonomy No.:
214092
-
Description:
The CO92 strain belongs to biovar Orientalis and its genome has been sequenced (Parkhill et al., 2001).
B. Lifecycle Information
:
-
Vegetative-cell
:
-
Size:
1-3 micrometer X 0.5-0.8 micrometer (Perry and Fetherston, 1997)
-
Shape:
Single or short-chained, plump, coccobacillus (Website 6, Website 20).
-
Picture(s):
-
Wayson stain of Yersinia pestis (Website 8):
Description:
Wayson stain of Yersinia pestis. Note the characteristic "safety pin" appearance of the bacteria. Copyright: CDC (Cornelis, 2002).
-
Other:
- Other charateristics
Bipolar staining (Website 20)
Gram-negative, non-motile, non-spore-forming, facultative anaerobe (Perry and Fetherston, 1997).
Yersinia pestis, the bubonic plague bacterium, is an R-form which has a genetic defect in the biosynthesis of complete lipopolysaccharide (LPS) and it lacks O-specific chains (Bruneteau and Minkab, 2003).
C. Genome Summary:
-
Genome of Yersinia pestis, CO92 strain, Yersinia pestis, KIM strain
-
Description: 7418
The complete genome sequences of Yersinia pestis strains CO92 and KIM are available (Parkhill et al., 2001, Dong et al., 2000, Deng et al., 2002).
More than 95% of the sequence is shared by the two genomes. The CO92 genome is approximately 4.65-megabase (Mb), which is about 50 kilobases (kb) larger than the KIM genome (Deng et al., 2002).
Both strains have plasmids of 96.2 kb, 70.3 kb, and 9.6 kb (Website 14, Parkhill et al., 2001, Deng et al., 2002).
A 5.9 kb plasmid has also been found in some Yersinia pestis isolates (Website 26, Dong et al., 2000).
-
Strain CO92 genome (Website 14, Parkhill et al., 2001):
-
GenBank Accession Number:
NC_003143
-
Size: 4653728 bp
-
Gene Count: 4008
-
Description: Yersinia pestis strain CO92, complete genome
-
Strain KIM genome (Website 24, Deng et al., 2002, Website 34):
-
GenBank Accession Number:
NC_004088
-
Size: 4600755 bp
-
Gene Count: 4198 predicted ORFs
-
Description: Yersinia pestis strain KIM, complete genome
-
Strain CO92 plasmid pCD1 (Website 3, Perry and Fetherston, 1997, Parkhill et al., 2001):
-
GenBank Accession Number:
NC_003131
-
Size: 70305 bp
-
Description: Yersinia pestis CO92 plasmid pCD1 (calcium dependence), complete sequence
-
Strain CO92 plasmid pPCP1 (Website 28, Perry and Fetherston, 1997, Parkhill et al., 2001):
-
GenBank Accession Number:
NC_003132
-
Size: 9612 bps
-
Description: Yersinia pestis CO92 plasmid pPCP1 (pesticin, coagulase, plasminogen activator), complete sequence
-
Strain CO92 plasmid pMT1 (Website 19, Perry and Fetherston, 1997, Parkhill et al., 2001):
-
GenBank Accession Number:
NC_003134
-
Size: 96210 bp
-
Description: Yersinia pestis CO92 plasmid pMT1 (murine toxin), complete sequence
-
Plasmid pYC (Website 26, Dong et al., 2000):
-
GenBank Accession Number:
NC_002144
-
Size: 5919 bp
-
Description: Yersinia pestis plasmid pYC, complete sequence
-
Strain KIM plasmid pMT1 (Website 29):
-
GenBank Accession Number:
NC_004835
-
Size: 100984 bp
-
Description: Yersinia pestis KIM plasmid pMT1, complete sequence
-
Strain KIM plasmid pCD1 (Website 30):
-
GenBank Accession Number:
NC_004836
-
Size: 70504 bp
-
Description: Yersinia pestis KIM plasmid pCD1, complete sequence
-
Strain KIM plasmid pPCP1 (Website 31):
-
GenBank Accession Number:
NC_004837
-
Size: 9610
-
Description: Yersinia pestis KIM plasmid pPCP1, complete sequence
-
Strain KIM plasmid pMT-1 (Website 32):
-
GenBank Accession Number:
NC_004838
-
Size: 100990
-
Description: Yersinia pestis KIM plasmid pMT-1, complete sequence
-
Strain KIM plasmid pCD1 (Website 33):
-
GenBank Accession Number:
NC_004839
-
Size: 70559
-
Description: Yersinia pestis KIM plasmid pCD1, complete sequence
II. Epidemiology Information
A. Outbreak Locations:
-
Reservoirs for Yersinia pestis are present on nearly every major continent (Perry and Fetherston, 1997).
-
Most human cases of plague are reported from developing countries in Asia and Africa. During 1990-1995, 12,988 cases of plague, with 1009 deaths (8%) were reported to the World Health Organization. The countries that reported more than 100 cases (from greatest to least) were Tanzania, Madagascar, Democratic Republic of Congo, Vietnam, Peru, India, Myanmar, Zimbabwe, Mozambique, Uganda, and China (Butler, 2000).
-
In the United States, about 10 cases occur each year; mostly in the southwestern states (Butler, 2000).
B. Transmission Information:
-
From:
Rat flea To:
Homo sapiens (Perry and Fetherston, 1997):
Mechanism:
Transmission of Yersinia pestis from fleas to humans occurs primarily via the bites of infected fleas (Perry and Fetherston, 1997).
Fleas acquire Yersinia pestis from an infected blood meal (Perry and Fetherston, 1997).
-
From:
Homo sapiens To:
Homo sapiens (Perry and Fetherston, 1997):
Mechanism:
Pneumonic plague epidemics can occur via the spread of respiratory droplets between humans, however this type of epidemic is currently uncommon due to the advent of effective antibiotics and modern public health measures (Perry and Fetherston, 1997).
-
From: Cat To: Human (Website 10):
Mechanism:
Inhaling droplets expelled by the coughing of a plague-infected animal (especially house cats) can result in plague of the lungs (plague pneumonia) (Website 10)
C. Environmental Reservoir:
-
Rodents
(Perry and Fetherston, 1997, Website 12, Website 16, Inglesby et al., 2000, Butler, 2000):
-
Description:
Plaque is primarily a zoonotic infection, occurring in urban or wild rodent populations (Perry and Fetherston, 1997, Butler, 2000, Website 12).
Rodents that could be characterized as enzootic hosts (i.e., in what rodent populations Yersinia pestis is found naturally) have not been conclusively identified, but certain species of rat, vole, mouse, and gerbil are suspected (Perry and Fetherston, 1997).
-
Survival Information:
Data from a study by Rose et al. (2003), suggest that Yersinia pestis maintains viability for extended periods under controlled conditions. Small numbers of cells suspended in phosphate buffer survived 2 to 4 hours after visible drying on stainless steel, polyethylene, or glass and beyond 48 hours on paper. Cells suspended in brain heart infusion broth (BHI) persisted more than 72 hours on stainless steel, polyethylene, and glass. Small numbers of cells suspended in BHI were still viable at 120 hours on paper (Rose et al., 2003).
Yersinia pestis may remain viable for months to years at freezing temperatures and may furthermore be viable in dry sputum, flea feces and buried bodies (Website 16).
Although some reports suggest that the bacterium may survive in the soil for some time, there is no evidence to suggest environmental risk to humans in this setting and thus no need for environmental decontamination of an area exposed to an aerosol of plague. Yersinia pestis is very sensitive to the action of sunlight and heating and does not survive long outside the host. In a World Health Organization (WHO) analysis, in a worst case scenario, a plague aerosol was estimated to be effective and infectious for as long as 1 hour. In the setting of a clandestine release of plague bacilli, the aerosol would have dissipated long before the first case of pneumonic plague occurred (Inglesby et al., 2000).
-
Rat flea
(Perry and Fetherston, 1997):
-
Description:
31 species (of the 1500 identified flea species) have been proven to be plaque vectors. Xenopsylla cheopis, the Oriental rat flea, is the classic vector for plaque and is the standard against which all other fleas are measured (Perry and Fetherston, 1997).
-
Mouse
(Guiyole et al., 1994):
-
Description:
Mouse can be infected with Yersinia pestis (Guiyole et al., 1994).
-
Other Mammals
(Website 11, Perry and Fetherston, 1997):
-
Description:
Over 200 species of mammals in 73 genera have been reported to be naturally infected with Yersinia pestis, however rodents are the most important hosts (Perry and Fetherston, 1997).
Identified hosts include rats, prairie dogs, squirrels, dogs, cats, and rabbits (Website 11).
D. Intentional Releases:
-
Intentional Release information
(Website 27):
-
Description:
The Japanese used the plague during their invasion of China before the outbreak of World War II. The agent was delivered by four different methods (see "delivery mechanism"). Several hundred Chinese civilians died as a result of these attacks and a Japanese unit that entered an infected area also suffered heavy casualties (Website 27).
-
Delivery mechanism:
Methods used by the Japanese to disseminate plaque in China: 1. Dropping contaminated rice for rats to feed on 2. Dropping contaminated materials such as lint 3. Dropping infected fleas over the target in a cluster bomb-like weapon called Uji that scattered porcelain bomblets containing infected fleas. The fleas were released when the bomblet shattered. 4. An attempt to use bacteria encapsulated in a water-soluble matrix (Website 27).
-
Intentional Release information
(Website 27, Website 20):
-
Description:
Yersinia pestis can be manufactured by fermentation at relatively low temperatures without affecting its properties as a biological warfare agent. Yersinia pestis can be stored relatively easily because it can survive at low or freezing temperatures for extended periods as long as there is water available. It can survive for 30 days in water. It can also be freeze-dried and stored for up to ten years without loss of viability, (i.e. can be revived and cultured). A 1970 study by the World Health Organization found that the the organism could remain viable for up to an hour after dispersal as an aerosol. Under poor conditions for dispersal, there is a rapid loss of viability (up to 70% per minute) depending on the temperature and humidity of the atmosphere (Website 27).
-
Emergency contact:
Contact the local FBI, state public health laboratory, and the state public health department. Local FBI agents will forward isolates to a state health department laboratory as is necessary. Consultation with a state health department laboratory is strongly encouraged as soon as Yersinia pestis is suspected as a bioterrorist threat agent (Website 20).
-
Delivery mechanism:
An aerosol made up of bacteria-containing droplets of the size best suited for absorption in the lungs (1-5 micrometers), dispensed over an unprotected population, could kill a very large percentage (90-100%) of those exposed (Website 27).
-
Containment:
The unique experience of plague control in its natural foci was accumulated in the Soviet Union in the 1930s-1970s. At that period the main measure taken for conditioning these foci was the extermination of rodents, the main carriers of plague, and their fleas as vectors with the aim of breaking, as it was then believed, the continuous process of the transmission of Yersinia pestis among rodents. These measures, carried out in many natural foci for several decades, did not bring desired results; in none of these areas natural foci of plague could not be liquidated, completely or in part. The experience of the anthropogenic transformation of the landscapes of the natural foci of plague revealed that the best antiplague effect was obtained after vast territories were completely plowed up and used afterwards annually for monoculture (Diatlov, 2003).
III. Infected Hosts
-
Human:
-
Taxonomy Information:
-
Species:
-
Human (Perry and Fetherston, 1997):
-
GenBank Taxonomy No.:
9606
-
Scientific Name: Homo sapiens
-
Description:
Humans play no role in the long-term survival of Yersinia pestis, but can become infected (Perry and Fetherston, 1997).
-
Infection Process:
-
Infectious Dose:
The LD50 of cells incubated at 25 degrees celcius is approximately 274 bacteria. For cells incubated at 37 degrees celcius, the LD50 decreases to approximately 12 bacteria. This is consistent with an alteration of expression of virulence factors that occurs during the transition period from growth in the flea to growth in mammals concomitant with a change in temperature. For bacteria introduced via the aerosol route (grown at 37 degrees celcius), the LD50 is 4 x 10 e4 (Perry and Fetherston, 1997).
Since the reported airborne infective dose of Y. pestis is estimated to be 10 e2 to 2 x 10 e4 organisms, appear inoculated with Y. pestis and held for 5 days under humidity ranges of 54-60% may still pose a threat to human infection (Rose et al., 2003).
-
Description:
When a flea ingests a blood meal from an organism infected with Yersinia pestis, the blood clots in the foregut of the flea, leading to blockage of the flea's swallowing. Yersinia pestis subsequently multiplies in the clotted blood. When an infected, blocked flea bites a human host, it may regurgitate thousands of bacteria into the human skin (Butler, 2000).
Once in the human skin, the bacteria spread to the regional lymph nodes. Yersinia pestis loses its protective capsule while in the gut of the flea due to the lower flea body temperature, therefore when it is injected into human tissue by the flea, the bacteria are easily phagocytosed by polymorphonuclear leukocytes (PMNs) and monocytes. In this early stage, Yersinia pestis phagocytosed by PMNs are largely destroyed. However, bacteria engulfed by monocytes are able to grow intracellularly and develop resistance to further phagocytosis by the temperature-dependent expression of the capsule and other virulence factors. During this period of bacterial replication, a lymph node may become inflamed and enlarged, forming a "bubo." Once matured, the bacteria enter the bloodstream where growth continues in the blood, liver, spleen, and eventually other organs including the lung (Perry and Fetherston, 1997).
If plague infection becomes pneumonic, direct person-to-person transmission via bacterial aerosolization becomes possible (Website 21).
-
Disease Information:
-
plague
(i.e., Yersinia pestis)
:
-
Pathogenesis Mechanism:
OVERVIEW: The core of the Yersinia pestis pathogenicity machinery is the Yop virulon, encoded on the 70-kb plasmid of pathogenic Yersinia species. The Yop virulon consists of three basic components: the Ysc injectisome, an organelle which spans the bacterial membrane, the Yop effectors, and the Yop translocators that are involved in delivering the effectors across the eukaryotic plasma membrane. Once injected, Yop proteins perturb the dynamics of the cytoskeleton (disrupting phagocytosis) and block the production of proinflammatory cytokines, thus favoring the survival of Yersinia pestis while inducing apoptosis in the macrophage. The Yop virulon is an archetype of the type III secretion system now identified in more than a dozen major animal or plant pathogens (Cornelis, 2002).
MECHANISM: Before contact with the eukaryotic target cells, Yersinia pestis builds several syringe-like organelles, called injectisomes, at its surface. The injectisome is a protein pump composed of 27 proteins that spans the peptidoglycan layer and the two bacterial membranes. It is topped off by a stiff needle-like structure that protrudes outside of the bacterium. It is generally assumed that the injectisome serves as a hollow conduit, allowing proteins to be exported to the eukaryotic cell (Cornelis, 2002).
Upon close contact with a target cell, some of the injectisomes become active and begin to secrete the Yop effectors. The required contact is not achieved by the needle itself, but by the interaction between bacterial outer membrane proteins, called adhesins, and integrins at the surface of a target cell. Translocation of the Yop effectors into the host cell requires the secretion of the translocator Yops (YopB, YopD, and LcrV) (Cornelis, 2002).
Once inside the eukaryotic cell, the Yop effectors inhibit signaling cascades and block the ability of the cell to respond to infection. Out of six effectors identified so far, four inhibit cytoskeleton dynamics (YopH, YopE, YopT, and YopO/YpkA). By doing so, they contribute to the strong resistance of pathogenic Yersinia to phagocytosis by macrophages and polymorphonuclear leukocytes. YopH is among the most powerful phosphotyrosine phosphatases (PTPase) known; when injected into J774 macrophages, YopH dephosphorylates p130Cas and disrupts focal adhesions. It also dephosphorylates the Fyn-binding protein Fyb and the scaffolding protein SKAP-HOM. The three other Yop effectors counteracting phagocytosis, YopE, YopT, and YpkA/YopO, act on monomeric GTPases of the Rho family, which are known to control the dynamics of the cytoskeleton. YopE acts as a GTPase-activating protein (GAP), switching RhoA, Rac1, and Cdc42 to the inactive state by accelerating GTP hydrolysis. YopT has been shown recently to be a cysteine protease that cleaves Rho, Rac, and Cdc42 near their COOH terminus, releasing them from the membrane. YpkA (for Yersinia protein kinase A) is an autophosphorylating serine-threonine kinase that shows some sequence and structural similarity to RhoA-binding kinases. YpkA is activated by actin binding, and actin can also function as an in vitro substrate of the kinase. Although binding of YpkA/YopO to actin and to RhoA and Rac-1 is clearly relevant in the context of phagocytosis inhibition, the kinase target and the exact mode of action of YpkA/YopO remain unknown (Cornelis, 2002).
Yop effectors also promote the intracellular survival of Yersinia by counteracting the normal proinflammatory response of cells to infection. YopJ reduces the release of TNF-alpha by macrophages and of IL-8 by epithelial and endothelial cells. It also reduces the presentation of adhesion molecules ICAM-1 and E-selectin at the surface of endothelial cells and presumably reduces neutrophil recruitment to the site of infection. All of these events result from the inhibition of activation of NF-kappaB, a transcription factor known to be of central importance in the onset of inflammation. YopJ inhibits IKK-beta, a kinase that phosphorylates I-kappaB, the inhibitor of NF-kappaB. By preventing phosphorylation of I-kappaB, YopJ prevents its degradation and thus prevents the translocation of NF-kappaB to the nucleus. Macrophages infected with Yersinia secreting YopJ also lack the usual activation of mitogen-activated protein kinases (MAPKs), c-junN-terminal kinase, p38, and extracellular signal-regulated kinase 1 and 2 due to the inhibition of upstream MAPK kinases (MKKs). Inhibition of the MAPK pathways abrogates phosphorylation of CREB, another transcription factor involved in the immune response. Last but not least, YopJ induces apoptosis of macrophages but not of other cell types. In 2000, it was suggested that YopJ is a cysteine protease, possibly a SUMO protease (SUMO are ubiquitin-like proteins that are involved in posttranslational modification). However, this result is not easy to link to the previous findings that YopJ interacts with the MKKs and IKK-beta pathways, preventing their phosphorylation (Cornelis, 2002).
It has been shown that YopH also contributes to the down-regulation of the inflammatory response. Indeed, YopH exerts an inhibitory effect on the synthesis of the monocyte chemoattractant protein 1, a chemokine involved in the recruitment of other macrophages to the sites of infection. Thus, YopH not only contributes to Yersinia's evasion of the innate immune response by inhibiting phagocytosis, but it also incapacitates the host adaptive immune response (Cornelis, 2002).
YopM is an important Yop effector in mouse infection, but its function has not yet been defined. It has been shown to migrate to the nucleus of target cells by means of a vesicle-associated pathway, and microarray experiments indicate that it influences gene transcription, leading to new working hypotheses that are now being tested (Cornelis, 2002).
In addition to the virulence factors encoded by the Yop virulon, at 37 degrees Celsius Yersinia pestis expresses a capsule-like antigen, fraction 1 (F1). F1 is encoded by the caf1 gene located on the 100-kb pFra plasmid. F1 is a surface polymer composed of a protein subunit, Caf1, with a molecular mass of 15.5 kDa. The secretion and assembly of F1 require the caf1M and caf1A genes, which are homologous to the chaperone and usher protein families required for biogenesis of pili. F1 has been implicated in the ability of Yersinia pestis to prevent uptake by macrophages through interference at the level of receptor interaction in the phagocytosis process. Thus, F1 and the virulence plasmid-encoded type III system act in concert to make Yersinia pestis highly resistant to uptake by phagocytes (Du et al., 2002).
-
Antiphagocytic action of the Yops (Cornelis, 2002):
Description:
Upon contact with a phagocyte receptor (R), a signaling cascade is triggered and GTP-bound Rho family members (RhoA, Rac-1, Cdc42) promote actin polymerization. YopE, acting as a GAP, down-regulates Rac-1, Cdc42, and RhoA. The YopT protease cleaves the COOH terminus of RhoA, Rac, and Cdc42, liberating them from the plasma membrane. The YpkA/YopO kinase becomes autophosphorylated upon contact with actin and interacts with RhoA and Rac-1. The PTPase YopH is targeted to focal adhesions and to other protein complexes where it dephosphorylates proteins such as the focal adhesion kinase (Fak), p130Cas, and SKAP-HOM. Used with permission (Cornelis, 2002).
-
Incubation Period:
An aerosolized plague weapon could cause fever, cough, chest pain, and hemoptysis with signs consistent of severe pneumonia 1 to 6 days after exposure (Inglesby et al., 2000).
The incubation period for bubonic plague is 2 to 8 days after the bite of an infected flea (Butler, 2000).
-
Symptom Information
:
-
Syndrome --
Bubonic Plague:
-
Description:
The most common manifestation of infection with Yersinia pestis is bubonic plague (Butler, 2000).
Initial symptoms include malaise, high fever, and one or more painful lymph nodes. The vast majority of buboes occur in the groin, as the legs are the most commonly flea-bitten part of the body, however, cervical and axillary lymph nodes may also be involved. Circulatory collapse, hemorrhage and peripheral thrombosis are the terminal events. About 50% of untreated bubonic plague cases will die (Website 16).
Symptoms Shown in the Syndrome:
-
Fever (Butler, 2000):
-
Description: Temperature of 38.5-40 degrees celcius
-
Buboes (Website 17):
-
Description:
Inguinal, axillary, cervical, or epitrochlear buboes usually no greater than 5 cm, extremely tender, erythematous, and surrounded by a boggy hemorrhagic area are seen. Patient often flexes, abducts, and externally rotates the hip near an involved inguinal node to reduce pain at the site (Website 17).
-
Observed:
Inguinal bubo (60%), axillary (30%), cervical (10%), or epitrochlear (10%) (Website 17).
-
Chills (Butler, 2000):
-
Weakness (Butler, 2000):
-
Headache (Butler, 2000):
-
Gastrointestinal complaints (Website 17):
-
Description:
Gastrointestinal complaints (may precede a bubo) (Website 17).
-
Abdominal tenderness (Website 17):
-
Description:
Diffuse abdominal tenderness, with or without guarding, splenomegaly, hematochezia, or heme-positive stools (Website 17).
-
Increased pulse (Butler, 2000):
-
Description:
Pulse rate is increased to 110-140 per minute (Butler, 2000).
-
Low blood pressure (Butler, 2000):
-
Description:
Blood pressure is low, usually in the range of 100/60 mm Hg, due to the extreme vasodilation (Butler, 2000).
-
Lesions and carbuncles (Website 17):
-
Description:
Rare cases of ecthyma gangrenosumlike lesions and carbuncles due to blood-borne Yersinia pestis have been described (Website 17).
-
Syndrome --
Pneumonic Plague:
-
Description:
In the pneumonic form, the onset of symptoms is acute and fulminant with high fever, chills, headache, malaise, myalgia, and cough (with sputum that may be clear, bloody, or purulent). Buboes on the neck are rare, but are a symptom of pneumonic plague. Nausea, diarrhea, vomiting, and abdominal pain may also accompany the disease. The pneumonia progresses rapidly, resulting in dyspnea, stridor, and cyanosis. The disease rapidly engulfs the lungs and hemorrhages develop, filling them with fluid (a hemorrhagic pneumonia). The terminal events are respiratory failure, circulatory collapse, and bleeding diathesis with mortality of 100% if not treated within the first 24 hours of infection (Website 27, Website 16, Website 17). Sequential chest radiographs of a patient with fatal primary plaque pneumonia can be viewed at the website below: http://www.mheducation.com/HOL2_chapters/HOL_chapters/chapter162.htm (Website 27, Website 16, Website 17)
Symptoms Shown in the Syndrome:
-
Cough (Website 27):
-
Description:
Cough with sputum that may be clear, bloody, or purulent (Website 27).
-
Fever (Website 27):
-
Myalgia (Website 27):
-
Malaise (Website 16):
-
Headache (Website 16):
-
Chills (Website 16):
-
Dyspnea (Website 27):
-
Abdominal pain (Website 27):
-
Nausea (Website 27):
-
Vomiting (Website 27):
-
Diarrhea (Website 27):
-
Buboes on the neck (Website 27):
-
Description:
Buboes on the neck (Website 27)
-
Observed: Rare
-
Syndrome --
Septicemic Plague:
-
Description:
A distinctive feature of plague, in addition to the bubo, is the propensity of the disease to overwhelm the patient with a massive growth of bacteria in the blood (Butler, 2000).
Occasionally, in the pathogenesis of plague infection, bacteria are inoculated and proliferate in the body without producing a bubo, hypothesized to occur when the bacillus is deposited in the vasculature, bypassing the lymphatics (Website 17, Butler, 2000).
Symptoms and signs are indistinguishable from other Gram-negative septicemias, and include septic shock and disseminated intravascular coagulation. Septicemic plague has a 40% mortality rate in treated cases and 100% mortality in untreated cases (Website 17).
Symptoms Shown in the Syndrome:
-
Septicemia (Butler, 2000):
-
Description:
Symptoms and signs of a Gram-negative septicemia (Butler, 2000).
-
Abdominal pain (Website 17):
-
Description:
Abdominal pain. Only presenting symptom more common in a patient presenting with septicemic plague (primary blood-borne plague) versus one presenting with bubonic plague (Website 17).
-
Fever (Butler, 2000):
-
Description:
Temperature of 38.5-40 degrees celcius (Butler, 2000).
-
DIC (Website 17):
-
Description:
Acral cyanosis, ecchymosis, petechiae, and digital gangrene are seen with Yersinia pestis septicemia (from disseminated intravascular coagulation [DIC]) (Website 17).
-
Syndrome --
Plague meningitis:
-
Description:
Plague meningitis is a rarer complication and typically occurs more than 1 week after inadequately treated bubonic plague. It results from hematogenous spread from a bubo and carries a high mortality rate compared to uncomplicated bubonic plague (Butler, 2000).
-
Observed:
Rare (Butler, 2000)
Symptoms Shown in the Syndrome:
-
Fever (Butler, 2000):
-
Headache (Butler, 2000):
-
Meningismus (Butler, 2000):
-
Pleocytosis (Butler, 2000):
-
Description:
Pleocytosis, with predominance of polymorphonuclear leukocytes (Butler, 2000).
-
Syndrome --
Pharyngeal plague:
-
Description:
Pharyngeal plague is very rare and possibly results from ingestion or inhalation of the organism. Manifests as pharyngitis that resembles acute tonsilitis (Butler, 2000).
-
Observed:
Very rare (Website 18, Butler, 2000)
Symptoms Shown in the Syndrome:
-
Swollen tonsils (Butler, 2000):
-
Inflamed lymph nodes (Butler, 2000):
-
Description:
Inflamed anterior cervical lymph nodes (Butler, 2000)
-
Treatment Information:
-
Streptomycin (Website 17, Butler, 2000):
Since 1948, streptomycin has been the drug of choice for the treatment of plague. No other drug has been demonstrated to be more efficacious or less toxic. Household contacts of patients with the bubonic or septicemic plague may have been exposed to the same fleas, thus antibiotic prophylaxis is recommended. Prophylaxis also is indicated for all contacts of patients with pneumonic plague (e.g., Emergency doctors and Emergency Medical Service personnel). Streptomycin should be administered intramuscularly (IM) in two divided doses daily, totaling 30 mg/kg of body weight per day for 10 days (Butler, 2000).
The pediatric dose is 20-30 mg/kg per day (IM) (Website 17).
Most patients improve rapidly and become afebrile in about 3 days. The 10 day course of streptomycin is recommended to prevent relapses (Butler, 2000).
-
Applicable:
Only streptomycin and tetracycline or doxycycline are approved for treatment and prophylaxis of plague by the Food and Drug Administration (FDA) of the United States; however, due to limited availability of streptomycin, gentamicin is often successfully substituted (Frean et al., 2003).
-
Contraindicator:
Streptomycin is contraindicated in patients with documented hypersensitivity and those with nondialysis-dependent renal insufficiency. Newborn infants with transplacental infection by plague should receive gentamicin instead. Unsafe in pregnancy (Website 17).
-
Complication:
Nephrotoxicity may be increased with aminoglycosides, cephalosporins, penicillins, amphotericin B, and loop diuretics. Due to narrow therapeutic index and toxic hazards associated with extended administration, not intended for long-term therapy; adjust dose in patients with renal impairment; caution in myasthenia gravis, renal failure (not on dialysis), hypocalcemia, and conditions that depress neuromuscular transmission (Website 17).
-
Gentamicin (Garamycin) (Website 1):
The loading dose with normal renal function is 2 mg/kg IV (intravenous)every 8 hours, and then a maintenance dose of 1.7 mg/kg IV every 8 hour for 10 days (Website 2).
The pediatric dose for children under 5 years is 2.5 mg/kg/dose IV (intravenous) every 8 hours. For children over 5 years, the dosage is 1.5-2.5 mg/kg/dose IV every 8 hours or 6-7.5 mg/kg/d divided every 8 hours, not to exceed 300 mg/d (Website 1).
-
Applicable:
Gentamicin (Garamycin) is an aminoglycoside used as an alternative to streptomycin and is equally effective in the treatment of plague (Website 1).
The United States Working Group on Civilian Biodefense recommended streptomycin or gentamicin as the preferred choice in a contained casualty setting (i.e. modest numbers of patients requiring treatment) with doxycycline, ciprofloxacin, or chloramphenicol as alternative choices (Frean et al., 2003).
-
Contraindicator:
Gentamicin (Garamycin) is contraindicated in patients with documented hypersensitivity; nondialysis-dependent renal insufficiency (Website 1).
-
Complication:
Coadministration with other aminoglycosides, cephalosporins, penicillins, and amphotericin B may increase nephrotoxicity; aminoglycosides enhance effects of neuromuscular blocking agents thus prolonged respiratory depression may occur. Coadministration with loop diuretics may increase auditory toxicity of aminoglycosides; possible irreversible hearing loss of varying degrees may occur (monitor regularly). Due to narrow therapeutic index, it is not intended for long-term therapy; caution in renal failure (patient not on dialysis), myasthenia gravis, hypocalcemia, and conditions that depress neuromuscular transmission; adjust dose in renal impairment; monitor serum levels (Website 1).
-
Kanamycin (Kantrex) (Website 1):
The adult dose is 15 mg/kg/d IV (intravenous) divided every 8 to 12 hours. The pediatric dose is 15-30 mg/kg/d IV divided every 8 to 12 hours (Website 1).
-
Applicable:
Kanamycin (Kantrex) is an aminoglycoside used as an alternative to streptomycin or gentamicin to treat plague (Website 1).
-
Contraindicator:
Kanamycin (Kantrex) is contraindicated in patients with documented documented hypersensitivity; nondialysis-dependent renal insufficiency (Website 1).
-
Complication:
Coadministration with other aminoglycosides, cephalosporins, penicillins, and amphotericin B may increase nephrotoxicity; aminoglycosides enhance effects of neuromuscular blocking agents thus prolonged respiratory depression may occur. Coadministration with loop diuretics may increase auditory toxicity of aminoglycosides; possible irreversible hearing loss of varying degrees may occur (monitor regularly). Due to narrow therapeutic index, it is not intended for long-term therapy; caution in renal failure (patient not on dialysis), myasthenia gravis, hypocalcemia, and conditions that depress neuromuscular transmission; adjust dose in renal impairment; monitor serum levels (Website 1).
-
Tetracycline (Website 17, Butler, 2000, Website 1):
Tetracycline is very effective for the treatment of plague. Household contacts of patients with the bubonic or septicemic plague may have been exposed to the same fleas, thus antibiotic prophylaxis is recommended. Prophylaxis also is indicated for all contacts of patients with pneumonic plague (e.g., Emergency Doctors and Emergency Medical Service personnel) (Website 17).
It is administered orally in a dose of 2-4 g/day in four divided doses for 10 days (Butler, 2000).
-
Applicable:
Plague treatment for patients that are allergic to streptomycin or who strongly prefer an oral drug (Butler, 2000).
Tetracycline (Sumycin) is frequently used for prophylaxis as well as treatment. It is usually substituted for streptomycin after a few days of therapy to minimize toxicity (Website 1).
-
Contraindicator:
Tetracycline is contraindicated in children less than 7 years old and in pregnant women (Butler, 2000).
Also contraindicated in patients with documented hypersensitivity and those diagnosed with severe hepatic dysfunction (Website 17).
-
Complication:
Bioavailability decreases with antacids containing aluminum, calcium, magnesium, iron, or bismuth subsalicylate; can decrease effects of oral contraceptives, causing breakthrough bleeding and increased risk of pregnancy; can increase hypoprothrombinemic effects of anticoagulants. Photosensitivity may occur with prolonged exposure to sunlight or tanning equipment; reduce dose in renal impairment; consider drug serum level determinations in prolonged therapy. Fanconilike syndrome may occur with outdated tetracycline (Website 17).
-
Doxycycline (Bio-Tab, Doryx, Doxy, Vibramycin, Vibra-Tabs) (Website 2):
Doxycycline inhibits protein synthesis and thus bacterial growth by binding to 30S and possibly 50S ribosomal subunits of susceptible bacteria. The adult dose is 100 mg PO (by mouth)/IV (intravenous) every 12 hours. Doxycycline is not recommended for children under 8 years. For children over 8 years, the dosage is 2-5 mg/kg/d in 1-2 divided doses; not to exceed 200 mg/d (Website 2).
-
Applicable:
Doxycycline is used as an alternative for tetracycline (Website 1).
-
Contraindicator:
Doxycycline is contraindicated in patients with documented hypersensitivity; severe hepatic dysfunction (Website 2).
-
Complication:
Bioavailability decreases with antacids containing aluminum, calcium, magnesium, iron, or bismuth subsalicylate; tetracyclines can increase hypoprothrombinemic effects of anticoagulants; tetracyclines can decrease effects of oral contraceptives, causing breakthrough bleeding and increased risk of pregnancy. Photosensitivity may occur with prolonged exposure to sunlight or tanning equipment; reduce dose in renal impairment; consider drug serum level determinations in prolonged therapy; tetracycline use during tooth development (last half of pregnancy through age 8 years) can cause permanent discoloration of teeth; Fanconilike syndrome may occur with outdated tetracyclines (Website 2).
-
Chloramphenicol (Website 17, Butler, 2000):
Chloramphenicol (Chloromycetin) is to be used in plague meningitis (due to better penetration into the cerebrospinal fluid), profound hypotension, pleural or pericardial involvement (Website 17, Butler, 2000).
It is administered intravenously with a loading dose of 25 mg/kg of body weight, followed by 60 mg/kg in four divided doses. After clinical improvement, chloramphenicol should be continued orally to complete a total course of 10 days (Butler, 2000).
-
Applicable:
Chloramphenicol can be used for treatment of patients with plague meningitis or for patients with profound hypotension in whom intramuscular injection may be poorly absorbed (Butler, 2000).
-
Contraindicator:
Chloramphenicol is contraindicated in patients with documented hypersensitivity (Website 17).
-
Complication:
Concurrently with barbiturates, chloramphenicol serum levels may decrease while barbiturate levels may increase, causing toxicity; manifestations of hypoglycemia may occur with sulfonylureas; rifampin may reduce serum chloramphenicol levels, presumably through hepatic enzyme induction; may increase effects of anticoagulants; may increase serum hydantoin levels, possibly resulting in toxicity; chloramphenicol levels may be increased or decreased. Safety for use during pregnancy has not been established (Website 17).
-
Other Chemotherapeutic Agents (Frean et al., 2003):
Cefditoren (Spectracef) is a semisynthetic cephalosporin administered as prodrug. Hydrolyzed by esterases during absorption and distributed in circulating blood as active cefditoren. Bactericidal activity results from inhibition of cell wall synthesis via affinity for penicillin-binding proteins. No dose adjustment necessary for mild renal impairment (CrCl 50-80 mgL/min/1.73 m2) or mild to moderate hepatic impairment (Website 4).
The dosage for adults and children over 12 years is 400 milligrams (mg) orally twice daily (with meals) for ten days. The dosage for children under 12 years is not yet established (Website 5).
In severe renal impairment (ie, CrCl under 30 mL/min/1.73 m2): Decrease dose to 200 mg PO qd (Website 4).
Ciprofloxacin (Cipro) is a fluoroquinolone with activity against most gram-negative organisms, but no activity against anaerobes. Inhibits bacterial DNA synthesis, and consequently, growth. The adult dose is 500 mg orally every 12 hours (when needed). It is not recommended for children under 18 years (Anderson et al., 2002).
-
Applicable:
There is in vitro and animal experiment evidence for efficacy of fluoroquinolones, but clinical trials have not been carried out. The United States Working Group on Civilian Biodefense recommended oral therapy with doxycycline or tetracycline, or ciprofloxacin for a mass casualty situation. Cefditoren (Spectracef, US) and the fluoroquinolones, both novel and conventional, showed excellent activity against the Yersinia pestis strains tested by Frean et al. (2003). The efficacy of fluoroquinolones has been demonstrated in a mouse model of plague and data by Frean et al. (2003) support further investigation of quinolones ABT 492 and olamufloxacin (HSR 903) in animal experiments (Frean et al., 2003).
-
Contraindicator:
The use of cefditoren is contraindicated in patients with documented hypersensitivity to drug, penicillin, related compounds, or milk protein sodium caseinate; carnitine deficiency or inborn errors of metabolism that may result in clinically significant carnitine deficiency (Website 4).
The use of ciprofloxacin is contraindicated in patients with documented hypersensitivity (Anderson et al., 2002).
-
Complication:
Absorption of cefditoren is reduced with H2 receptor antagonists and antacids of magnesium and aluminum hydroxides may reduce absorption; probenecid may increase plasma concentrations. It is usually safe in pregnancy but benefits must outweigh the risks. Cefditoren may cause diarrhea, nausea, and vaginal moniliasis (yeast infection); pseudomembranous colitis may occur; clinical manifestations of carnitine deficiency may occur with prolonged use; prolonged use may result in emergence and overgrowth of resistant organisms; caution in breastfeeding (Website 4).
Ciprofloxacin interacts with antacids, iron salts, and zinc salts may reduce serum levels; administer antacids 2-4h before or after taking fluoroquinolones; cimetidine may interfere with metabolism of fluoroquinolones; ciprofloxacin reduces therapeutic effects of phenytoin; probenecid may increase ciprofloxacin serum concentrations; may increase toxicity of theophylline, caffeine, cyclosporine, and digoxin (monitor digoxin levels); may increase effects of anticoagulants (monitor PT). The safety of ciprofloxacin for use during pregnancy has not been established. Ciprofloxacin may cause seizures; avoid in renal insufficiency and in patients with central nervous system (CNS) disorders (Anderson et al., 2002).
-
Novel Therapeutic Agents: Aurintricarboxylic Acid (ATA) (Liang et al., 2003):
The most potent and specific YopH inhibitor is aurintricarboxylic acid (ATA), which exhibits a Ki value of 5 nM for YopH and displays 6 to 120-fold selectivity in favor of YopH against a panel of mammalian PTPs. These results provide a proof-of-concept for the hypothesis that small molecule inhibitors that selectively target YopH may be therapeutically useful (Liang et al., 2003).
-
Applicable:
Aurintricarboxylic Acid is a potent and selective YopH inhibitor and a novel anti-plague agent (Liang et al., 2003).
-
Prevention:
-
Greer inactivated vaccine (Website 27, Perry and Fetherston, 1997):
-
Description:
The Greer inactivated vaccine, made from formalin-treated Yersinia pestis (195/P), was available until 1999 (Website 27, Perry and Fetherston, 1997).
-
Efficacy:
-
Complication:
Experimental evidence indicated that the Greer vaccine did not provide protection against the pneumonic for the disease (Perry and Fetherston, 1997).
-
Live, avirulent vaccines (Perry and Fetherston, 1997):
-
Description:
The live vaccine was derived from a Pgm-negative attentuated strain, usually related to EV76 (Perry and Fetherston, 1997).
-
Experimental Subunit Vaccine - Porton Down (Williamson et al., 2001, Website 25, Jones et al., 2003):
-
Description:
A 2001 report from Porton Down in the United Kingdom, showed that a subunit vaccine, prepared by admixing F1 antigen derived from a Yersinia pestis cell culture supernatant (reported to be greater than 90% pure) with recombinant V antigen derived from an E. coli cell lysate, fully protected an outbred strain of mouse against aerosol exposure to 10 e6 colony-forming units of virulent plague organisms (10 e4 mouse lethal doses) (Williamson et al., 2001).
A fully recombinant sub-unit vaccine comprising the protein antigens rF1+rV has been demonstrated to protect immunised guinea pigs against exposure to 10 e5 colony-forming units (CFU) of virulent Yersinia pestis. Additionally, IgG purified from rF1+rV-immunised guinea pig serum, protected the mouse by passive immunisation against challenge with Y. pestis (indicating conservation of neutralising epitopes between species.) whereas IgG purified from the serum of guinea pigs immunised with a licensed killed whole cell (KWC) vaccine for plague, protected less well (Jones et al., 2003).
In contrast, the Greer vaccine (a formalin-treated whole cell vaccine that is licensed for human use, but no longer available) protected only 16% of the challenged animals (Williamson et al., 2001).
These findings indicate that the reduced efficacy of the licensed killed whole cell vaccine formulation previously observed in the mouse can be attributed to lack of the V antigen. Cross-protection of the mouse with guinea pig IgG suggests that the recognition of neutralising epitopes in the F1 and V proteins is conserved between these two species. It has been demonstrated that the rF1+rV plague vaccine is immunogenic in a two-dose schedule in guinea pigs and protects against at least 10 LD's of organism challenge. Thus, the rF1+rV vaccine is efficacious in the guinea pig (Jones et al., 2003).
The (F1+rV) vaccine was subsequently shown to be safe in phase 1 human trials and is slated to begin phase 2 trials in the beginning of 2003. Porton Down scientists are maintaining a collaborative spirit with United States Army Medical Research Institute of Infectious Diseases (USAMRIID) researchers who are also developing a subunit vaccine based on the F1 and V antigens (Website 25).
-
Experimental Subunit Vaccine - USAMRIID (Website 25):
-
Description:
Scientists at the United States Army Medical Research Institute of Infectious Diseases (USAMRIID), are developing a subunit vaccine based on a fusion protein of the F1 and V antigens. Preclinical testing in both mice and nonhuman primates has showed efficacy against aerosolized plague. USAMRIID scientists are maintaining a collaborative spirit with Porton Down, United Kingdom researchers who are also developing a subunit vaccine based on the F1 and V antigens (Website 25).
-
Other Experimental Vaccines as Prevention Methods (Grosfeld et al., 2003, Osorio et al., 2003, Garmory et al., 2003):
-
Description:
Three plasmids expressing derivatives of the Yersinia pestis capsular F1 antigen were evaluated for their potential as DNA vaccines. These included plasmids expressing the full-length F1, F1 devoid of its putative signal peptide (deF1), and F1 fused to the signal-bearing E3 polypeptide of Semliki Forest virus (E3/F1). Intramuscular vaccination of mice with these plasmids revealed that the vector expressing deF1 was the most effective in eliciting anti-F1 antibodies. This response was not limited to specific mouse strains or to the mode of DNA administration, though gene gun-mediated vaccination was by far more effective than intramuscular needle injection. Vaccination of mice with deF1 DNA conferred protection against subcutaneous infection with the virulent Y. pestis Kimberley53 strain, even at challenge amounts as high as 4,000 LD50. Antibodies appear to play a major role in mediating this protection, as demonstrated by passive transfer of anti-deF1 DNA antiserum (Grosfeld et al., 2003).
Using a raccoon poxvirus (RCN) expression system, Osorio et al., 2003 developed new recombinant vaccines that can protect mice against lethal plague infection. They evaluated the efficacy of the viral vector, raccoon poxvirus (RCN), as a vaccine delivery system for the F1 capsular antigen of Y. pestis. After insertion of the gene for the F1 capsular antigen of Y. pestis into the RCN genome, the combination of several elements that affect translation or secretion of the F1 antigen to optimize in vitro antigen expression, in vivo antibody immune response, and protection against lethal Y. pestis challenge in mice was examined (Osorio et al., 2003).
A Salmonella vaccine strain expressing the V antigen as a fusion to the F1 antigen of Y. pestis has been reported. However, co-synthesis of V antigen caused a significant reduction in the yield of F1 antigen by Salmonella, and although protective immunity against plague was afforded, this was only achieved following intravenous (rather than oral) administration of the recombinant Salmonella strain. In contrast, Garmory et al., (2003) described the use of an aroA attenuated strain of S. enterica serovar Typhimurium for delivery of the Y. pestis V antigen as a candidate orally-delivered plague vaccine. Following challenge with Y. pestis GB, 6 out of 20 mice immunised with SL3261/pTrc-LcrV were protected against plague. In comparison, 44 out of the 45 control mice died within 9 days. This study is the first report of protection against plague afforded by oral immunisation of Salmonella expressing V antigen alone (Garmory et al., 2003).
-
Model System:
-
Mouse models:
-
Model Host:
Mouse.
-
Model Pathogens:
-
Description:
Different mouse models have been used. For example, the severe combined immunodeficient/beige mice reconstituted with hyperimmune Balb/c lymphocytes can be used as a model to demonstrate adoptive and passive protection against plague infection (Website 26).
The Porton outbred mice, BALB/c mice, (Williamson et al., 2000)
and CBA mice have also been used in plague research (Eyles et al., 1998).
The F1+ strain (GB) of Y. pestis is often used with the mouse model (Williamson et al., 2000, Eyles et al., 1998).
IV. Labwork Information
A. Biosafety Information:
-
General biosafety information
:
-
Biosafety Level:
2 (Website 15)
-
Precautions:
-
Biosafety Level 2 practices, containment equipment and facilities are recommended for all activities involving the handling of potentially infectious clinical materials and cultures. Special care should be taken to avoid the generation of aerosols from infectious materials and during the necropsy of naturally or experimentally infected rodents. Gloves should be worn when handling field-collected or infected laboratory rodents and when there is the likelihood of direct skin contact with infectious materials. Necropsy of rodents is ideally conducted in a biological safety cabinet. Immunization is recommended for personnel working regularly with cultures of Yersinia pestis or infected rodents (Website 15).
-
General biosafety information
:
-
Biosafety Level:
3 (Website 15)
-
Precautions:
-
Biosafety level 3 practices should be used for activities with high potential for droplet or aerosol production, for work with antibiotic-resistant strains, and for activities involving production quantities or concentrations of infectious materials (Website 15).
B. Culturing Information:
-
Sheep Blood Agar (SBA)
:
-
Description:
Sheep blood agar (SBA) is a general bacteriologic medium used for the isolation and examination of colonial morphology of bacterial organisms. Yersinia pestis organisms are not fastidious and will grow well on any nutrient medium including SBA. Plague bacilli grow slower than most bacteria at 37 degrees celcius, but at 28 degrees celcius they will grow faster than most. Enrichment of medium with 6% sheep red blood cells instead of the standard 5% provides more nutrition and shortens the incubation period. Even though Yersinia pestis may grow faster at 28 degrees celcius, a plate should also be incubated at 37 degrees celcius since diagnostic tests for plague depend primarily on expression of the temperature-regulated F1 antigen (Website 20).
Procedure: For cultures, use the sterile loop/stick to inoculate SBA plates. For tissues, the samples are obtained by using the sterile wood stick to punch into the tissue several times, especially in visibly necrotic areas, and then transferring the materials on the wood stick to the agar surface. Inoculate two SBA plates and streak to obtain isolated colonies. For safety, tape the top and bottom of the petri dish together in two places to keep them together; incubate plates, one at 28 degrees celcius (for faster growth) and another at 37 degrees celcius (for F1 antigen expression), for at least 24-48 hours. Examine plates for characteristic colonies (Website 20).
-
Medium:
-
Sheep blood agar plates (4-6% sheep blood) (Website 20).
-
Optimal Temperature:
28 degrees celcius (Website 20)
-
Upper Temperature:
37 degrees celcius (Website 20)
-
Lower Temperature:
25 degrees celcius (Website 20)
-
Optimal pH:
7.2 to 7.6 (Website 20)
-
Upper pH:
9.6 (Quan, 1987)
-
Lower pH:
5.0 (Quan, 1987)
-
doubling-time:
1.25 hours/generation time (Website 20)
-
Note:
Sheep blood agar (SBA) plates are used as the standard solid medium for the isolation and culture of Yersinia pestis. If, however, SBA plates are not available, other general solid medium such as brain heart infusion agar, nutrient agar or trypticase soy agar may be used, though growth of the organism will be slower and colonies will be smaller (Website 20).
Atmosphere: Ambient, use of 5% CO2 is acceptable. Hold primary plates for 5 days. Plates should be held for up to 7 days if the patient has been treated with bacteriostatic antibiotic. Yersinia pestis colonies are gray-white, translucent, usually too small to be seen as individual colonies at 24 hours. After incubation for 48 hours, colonies are about 1-2 mm in diameter, gray-white to slightly yellow, and opaque. Under 4X enlargement, after 48-72 hour of incubation, colonies have a raised, irregular "fried egg" appearance, which becomes more prominent as the culture ages. Colonies also can be described as having a "hammered copper," shiny surface. There is little or no hemolysis of the sheep red blood cells (Website 6).
-
Nutrient-rich broths
:
-
Description:
Yersinia pestis grows well in nutrient-rich broth such as brain heart infusion (BHI), trypticase soy or nutrient broth. The organisms exhibit a characteristic growth formation in clear broth, whose appearance may be used as an aid to its identification. Because of its slower growth, Yersinia pestis may be quickly overwhelmed by contaminants, but the characteristic clumped growth may still be seen in the broth tube growth. Inoculation in clear, enriched media such as BHI may assist in the recovery of Yersinia pestis, but is not critical to isolation (Website 20).
Procedure: Specimens taken from clinical materials or pure cultures should be inoculated into two broth tubes and incubated at 28 degrees celcius (for faster growth) and at 37 degrees celcius (for expression of the diagnostic F1 antigen). Cultures should be incubated for 24-48 hours without agitation. At that time, carefully remove tubes, without agitation, from the incubator, and examine for the characteristic growth pattern. The cultures in broth can be described as suspended flocculent or crumbly clumps ("stalactites"). These clumps are visible at the side and bottom of the tube with the rest of the medium remains clear (an image of Yersinia growth in BHI broth tubes can be viewed at Website 20). Longer incubation will result in the clumps of cells falling to the bottom of the tube and loss of the characteristic formation, but the medium above will still remain clear. The characteristic formation of Yersinia pestis cells can be seen in broth culture even if the culture is contaminated; the broth will be cloudy but the clumps will be visible (Website 20).
-
Medium:
-
Brain heart infusion broth (BHI). There must be at least 5 cm of BHI in the tube to correctly visualize the characteristic growth of Yersinia pestis (Website 20).
-
Optimal Temperature:
28 degrees celcius (Website 20)
-
Upper Temperature:
37 degrees celcius (Website 20)
-
Lower Temperature:
25 degrees celcius (Website 20)
-
Optimal pH:
7.2 to 7.6 (Website 20)
-
doubling-time:
1.25 hours/generation time (Website 20)
-
Note:
Sample preparation for culturing: Lower respiratory tract (pneumonic): Bronchial wash or transtracheal aspirate (1 ml). Sputum may be examined but this is not advised because of contamination by normal throat flora. Blood (septicemic): Collect appropriate blood volume and number of sets per established laboratory protocol. Note: In suspected cases of plague, an additional blood or broth culture (general nutrient broth) should be incubated at room temperature (22-28 degrees celcius), the temperature at which Yersinia pestis grows faster. Do not shake or rock the additional broth culture so that the characteristic growth formation of Yersinia pestis can be clearly visualized. Aspirate of involved tissue (bubonic) or biopsied specimen: Liver, spleen, bone marrow, lung. Note: Aspirates may yield little material; therefore, a sterile saline flush may be needed to obtain an adequate amount of specimen. Syringe and needle of aspirated sample should be capped, secured by tape, and sent to the laboratory. Respiratory/sputum: Transport specimens in sterile, screw-capped containers at room temperature. If it is known that material will be transported from 2-24 hours after collection, then store container and transport at 2-8 degrees celcius. Blood: Transport samples directly to the laboratory at ambient temperature. Hold them at ambient temperature until they are placed onto the blood culture instrument or incubator. Do not refrigerate. Follow established laboratory protocol for processing blood cultures. Tissue aspirate/biopsy specimen: Submit tissue or aspirate in a sterile container. For small samples, add 1-2 drops of sterile normal saline to keep the tissue moist. Transport the sample at room temperature for immediate processing. Keep the specimen chilled if processing of the specimen will be delayed (Website 6).
-
BIN selective agar
:
-
Description:
Growth of Yersinia pestis on BIN selective agar: Existing media designed for selective isolation of clinically important members of the genus Yersinia were found to be unsatisfactory for the growth and isolation of Yersinia pestis. Ber et al., (2003) reported the development of a new selective agar medium (termed BIN) that supports the growth of Y. pestis. The development of the formulation of this medium was based on a fluorescence screening system designed for monitoring bacterial growth on semisolid media, using a green fluorescent protein-expressing strain. High-throughput combinatorial experiments can be conducted for the quantitative evaluation of the effect of different medium components on growth. Generation of fluorescence plots in this system, using microplates, allowed the quantitative evaluation of the growth rate of Y. pestis EV76 cultures in different agar compositions (Ber et al., 2003).
The final BIN formulation is based on brain heart infusion (BHI) agar, to which the selective agents irgasan, cholate salts (sodium cholate and sodium deoxycholate), crystal violet, and nystatin were introduced. It was found that BIN agar is more efficient in supporting colony formation and recovery of Y. pestis than are the conventional semisolid media MacConkey agar and Yersinia-selective agar (cefsulodin-irgasan-novobiocin agar) (Ber et al., 2003).
In summary, the BIN medium is superior to the WHO-recommended selective medium, MacConkey medium, as well as to the commercial CIN medium for the isolation and recovery of Y. pestis from pure and fresh samples as well as from background environments where the bacterium is expected to be under stress (Ber et al., 2003).
-
Medium:
-
The BIN formulation is based on brain heart infusion (BHI) agar, to which the selective agents irgasan (0.0008 g/liter), cholate salts (sodium cholate (0.5 g/liter) and sodium deoxycholate (0.5 g/liter)), crystal violet (0.001 g/liter), and nystatin (0.025 g/liter) were introduced (Ber et al., 2003).
C. Diagnostic Tests
:
-
Organism Detection Tests:
-
Gram stain (Website 6, Website 9, Perry and Fetherston, 1997, Website 20, Butler, 2000):
-
Description:
The Gram stain can be used as supportive, but not confirmatory evidence of Yersinia pestis infection (Website 9, Perry and Fetherston, 1997, Website 20).
Procedure: Gram stain per standard laboratory protocol. Smears for staining may be prepared in order of likely positive results (i.e., cultures, bubo aspirates, tissue, blood, and sputum specimens) (Website 6).
Because a bubo does not contain liquid pus, it may be necessary to inject saline into the bubo and immediately reaspirate it (Butler, 2000).
Interpretation: Stained specimens containing Yersinia pestis often reveal plump, gram-negative rods, 1-2 micrometer X 0.5 micrometer, that are seen mostly as single cells or pairs and short chains in liquid media (see Website 6 or Website 20 for an image of Yersinia pestis Gram stain). Note: Patients with pneumonic plague may be secondarily infected with Streptococcus pneumoniae. Both of these organisms may be visualized in the sputum smears. It is imperative to evaluate such smears for the presence of gram-negative rods around the leukocytes (not necessarily intracellularly) (Website 20, Website 6).
-
Differential stains (Website 6, Website 9, Perry and Fetherston, 1997, Website 20, Butler, 2000):
-
Time to Perform:
minutes-to-1-hour
-
Description:
The Wright-Giemsa or Wayson differential stains can be used as supportive, but not confirmatory evidence of Yersinia pestis infection (Website 9, Perry and Fetherston, 1997, Website 20).
The Wright-Giemsa stains are the most reliable for accurately highlighting the bipolar staining characteristics of Yersinia pestis, whereas the Gram stain may not (Website 6).
The most suitable materials for differential staining include a bubo aspirate, sputum, blood smears and tissues (lung, spleen, liver) (Website 20).
Procedure: A detailed protocol for Wright-Giemsa/Wayson staining is available at Website 20. Interpretation: Consistent, striking bipolar safety-pin morphology of plump bacilli is characteristic of Yersinia, Pasteurella species, and other organisms (see Website 20 or Website 6 for image). All Yersinia pestis may stain as bipolar cells, but all bipolar-staining cells are not Yersinia pestis. Therefore, specimens taken from areas with a wide variety of normal flora (nasal, pharyngeal, and throat) may lead to mistaken interpretation. Bacterial cells picked from freshly passaged agar/broth growth tend to exhibit very little bipolarity, because the cells are too small; however, upon prolonged incubation, the cells would be more likely to exhibit the characteristic bipolar safety-pin shapes. When stained smear reveals the cells with the characteristic safety-pin morphology, the specimen should be forwarded to the state health department for isolation, identification and evaluation (Website 20).
-
Fluorescent Antibody Test (Website 9, Perry and Fetherston, 1997):
-
Time to Perform:
1-hour-to-1-day
-
Description:
A positive fluorescent antibody test for the F1 antigen can be used as presumptive evidence of a Yersinia pestis infection (Website 9, Perry and Fetherston, 1997).
The antibody is available at many western United States hospitals and from the Centers for Disease Control. The F1 antigen is predominantly expressed by Yersinia pestis at 37 degrees celcius. Samples that have been refrigerated for more than 30 hours, from cultures that were incubated at room temperatures less than 35 degrees celcius, or from fleas, will be negative (Perry and Fetherston, 1997).
-
Yersinia pestis broth culture appearance:
-
Time to Perform:
1-to-2-days
-
Description:
After 24-48 hours of incubation, a broth culture of Yersinia pestis can be described as suspended flocculent or crumbly clumps ("stalactites"). These clumps are visible at the side and bottom of the tube with the rest of the medium remaining clear (an image of Yersinia growth in broth tubes can be viewed at Website 20). Longer incubation will result in the clumps of cells falling to the bottom of the tube and loss of the characteristic formation, but the medium above will still remain clear. The characteristic formation of Yersinia pestis cells can be seen in broth culture even if the culture is contaminated; the broth will be cloudy but the clumps will be visible (Website 20).
-
Yersinia pestis colony appearance:
-
Time to Perform:
2-to-7-days
-
Description:
Yersinia pestis grows as gray-white, translucent colonies, usually too small to be seen as individual colonies at 24 hours. After incubation for 48 hours, colonies are about 1-2 mm in diameter, gray-white to slightly yellow color and opaque. Highly passaged and laboratory adapted strains grow faster and colonies are larger. Under 4X enlargement, after 48-72 hours of incubation, colonies have a raised, irregular "fried egg" morphology, which becomes more prominent as the culture ages (see image at Website 20). Colonies can also be described as having a "hammered copper," shiny surface (see image at Website 20). There is little or no hemolysis of the sheep red blood cells (Perry and Fetherston, 1997, Website 20).
-
Lysis by specific bacteriophage:
-
Description:
Lysis by a specific bacteriophage is used by the Centers for Disease Control to conclusively identify Yersinia pestis (Website 9, Perry and Fetherston, 1997).
Bacteriophage preparations and protocols for their use are available from plague reference laboratories (Quan, 1987).
-
Immunoassay Tests:
-
Antibody detection (Website 9, Perry and Fetherston, 1997):
-
Time to Perform:
1-hour-to-1-day
-
Description:
Serologic data can be used to assess Yersinia pestis infection, however it is not considered a rapid diagnostic technique and is therefore, often used retrospectively to confirm cases of plague (Perry and Fetherston, 1997).
Samples are analyzed for anti-F1 antibodies by passive hemagglutination testing (Website 9, Perry and Fetherston, 1997).
Plague is presumed if a single serum sample has a >1:10 anti-F1 antibody titer. Plague is considered confirmed when one of the following two agglutination conditions are met: (1) if two serum specimens demonstrate a four-fold anti-F1 antigen titer difference, (2) if a single serum sample has a titer of >1:128, and the patient has no known previous plague exposure or vaccination history (Website 9, Perry and Fetherston, 1997).
-
Antigen capture ELISA (Chanteau et al., 2000):
-
Time to Perform:
1-hour-to-1-day
-
Description:
In 2000, Chanteau et. al. reported results from using an F1 antigen capture ELISA (developed and provided by the Naval Medical Research Institute, Bethesda, Maryland, USA) on patient samples in Madagascar. Using bacteriology as the gold standard reference assay, the sensitivity of the F1 ELISA was 100% in bubo aspirates, 52% in serum, and 58% in urine specimens. In culture-negative patients, the F1 ELISA was positive in 10% of bubo aspirates, 5% of serum, and 7% of urine specimens for whom a seroconversion for anti-F1 antibodies was also observed (Chanteau et al., 2000).
-
False Negative: 0% in bubo aspirate, 48% in serum, 42% in urine
-
Immunochromatography - dipstick assay (Website 25, Chanteau et al., 2000):
-
Time to Perform:
minutes-to-1-hour
-
Description:
In 2000, Chanteau et. al. reported results from using an F1 dipstick assay (developed and provided by the Naval Medical Research Institute, Bethesda, Maryland, USA) on patient samples in Madagascar. The sensitivity of the assay was 98% on bubo aspirates (Chanteau et al., 2000). Subsequently, Dr. Chanteau reported that they had developed a dipstick assay that could be performed directly on clinical samples including sputum. The assay had a cut-off of 0.5 ng F1/ml and was used to confirm 600 cases of suspected plague in Madagascar (Website 25).
-
Immunochromatography - dipstick assay (Chanteau et al., 2003):
-
Time to Perform:
minutes-to-1-hour
-
Description:
In 2003, Chanteau et. al. reported a rapid diagnostic test (RDT) for bubonic and pneumonic plague that used monoclonal antibodies to the F1 antigen of Yersinia pestis. The RDT is a specific, sensitive, and reliable test that can easily be done by health workers at the patient's bedside, for the rapid diagnosis of pneumonic and bubonic plague. This test will be of key importance for the control of plague in endemic countries. The RDT was derived from a prototype developed by the Naval Medical Research Institute (Bethesda, Maryland, USA) and assessed in Madagascar. For this new test, a combination of hybridomas B181 and G618, produced at the Institut Pasteur was used. The original RDT combined F104-A-G1 Mab with a polyclonal rabbit antiserum, and was based on one-step, vertical-flow immunochromatography. The RDT is as specific as, and at least as sensitive as, the two available standard methods. The excellent specificity of the RDT, its low detection threshold, and the higher number of positive specimens detected among samples from patients with suspected plague, suggest a greater sensitivity than bacteriology and ELISA (Chanteau et al., 2003).
-
Immunomagnetic Separation - Flow Cytometry Detection Method (Splettstoesser et al., 2003):
-
Time to Perform:
minutes-to-1-hour
-
Description:
Splettstoesser et al., (2003) introduced and evaluated a combination of immunomagnetic separation and flow cytometry for the serodiagnosis of human plague. The preparation of paramagnetic beads indirectly coated with F1 capture antigen (F1 CA) took approximately 90 min. The time for preparing and analyzing 20 serum samples was 110 min for the flow cytometric assay. Compared with a recently published combination of an anti-F1 CA enzyme-linked immunosorbent assay (ELISA) and immunoblot, the new assay showed the same sensitivity as the ELISA and almost the same specificity (99.0 versus 100%) as the immunoblot (Splettstoesser et al., 2003).
-
Bioluminescence - AB cell-based sensor (Rider et al., 2003):
-
Time to Perform:
minutes-to-1-hour
-
Description:
A pathogen sensor that achieves an optimal combination of speed and sensitivity through the use of B lymphocytes: members of the adaptive immune system that have evolved to identify pathogens very efficiently. B cell lines were engineered to express cytosolic aequorin, a calcium-sensitive bioluminescent protein from the Aequoria victoria jellyfish, as well as membrane-bound antibodies specific for pathogens of interest. Cross-linking of the antibodies by even low levels of the appropriate pathogen elevated intracellular calcium concentrations within seconds, causing the aequorin to emit light. Rider et al., (2003) named the sensor CANARY (Cellular Analysis and Notification of Antigen Risks and Yields). Cells specific for Yersinia pestis, the bacterium that causes plague, could detect as few as 50 colony-forming units (CFU) in a total assay time of less than 3 min, which included a concentration step. The probability of detection for Y. pestis ranged from 62% for 20 CFU to 99% for 200 CFU, whereas the false-positive rate for the CANARY assay was 0.4%. These cells did not respond to large numbers of unrelated bacteria (Francisella tularensis), nor did excess F. tularensis block the response to very low levels of Y. pestis (Rider et al., 2003).
-
Nucleic Acid Detection Tests:
:
-
Nuclease PCR assay:
-
Time to Perform:
1-hour-to-1-day
-
Description:
A 5' nuclease PCR assay for detection of the Yersinia pestis plasminogen activator (pla) (GenBank accession no. M27820) gene in human respiratory specimens with simulated Y. pestis infection was developed. An internal positive control was added to the reaction mixture in order to detect the presence of PCR inhibitors that are often found in biological samples. The assay was 100% specific for Y. pestis. In the absence of inhibitors, a sensitivity of 10 e2 CFU/ml of respiratory fluid was obtained. When inhibitors were present, detection of Y. pestis DNA required a longer sample treatment time and an initial concentration of bacteria of at least 10 e4 CFU/ml. The test's total turnaround time was less than 5 hrs. The assay described here is well suited to the rapid diagnosis of pneumonic plague, the form of plague most likely to result from a bioterrorist attack. The sequence of the minor group binder probe was 6-carboxyfluorescein-5'-GACTTGCAGGCC-3'[positions 840-851] (Loiez et al., 2003).
-
Primers:
-
Pair of primers
-
Forward:
positions 816-838: 5'-GAAAGGAGTGCGGGTAATAGGTT-3'
-
Reverse:
positions 869-884: 5'-AACCAGCGCTTTTCTA-3'
-
Chromosomal DNA Amplification:
-
Time to Perform:
1-hour-to-1-day
-
Description:
A primer pair that anneals to Yersinia pestis chromosomal DNA sequences was reported in 2001. The primers amplified a 276 bp product from strains of the three recognized biotypes (biovars) of Yersinia pestis. The primers did not amplify sequences from Yersinia pseudotuberculosis and did not cross-react with a collection of DNAs from bacterial, viral, and mammalian sources (Radnedge et al., 2001).
-
Primers:
-
Pair of primers
-
Forward:
TGTAGCCGCTAAGCACTACCATCC
-
Reverse:
GGCAACAGCTCAACACCTTTGG
-
Product
-
Combinational PCR Assays:
-
Time to Perform:
1-hour-to-1-day
-
Description:
In 2000, a combination of four polymerase chain reaction (PCR) assays targeting the Yersinia pestis-specific plasmoidal genes of the fraction 1 capsular antigen and plasminogen activator/coagulase, the gene of the V antigen of the Yersinia virulence plasmid, and the chromosomal 16S rRNA gene was used for the identification of Yersinia pestis isolates. The combination of PCR assays correctly identified 18 Yersinia pestis isolates, however all 4 assays are needed to differentiate Yersinia pestis from other pathogenic Yersinia species (Neubauer et al., 2000).
-
Primers:
-
Pair of primers
-
Forward:
atcttactttccgtgagaag
-
Reverse:
cttggatgttgagcttccta
-
Product
-
Name: plasminogen activator/coagulase
-
Size: 478 bp
-
Pair of primers
-
Forward:
cctacgaacaaaacccacaa
-
Reverse:
ggatttatcatggatatttatgg
-
Product
-
Name: V antigen
-
Size: 524 bp
-
Pair of primers
-
Forward:
ccctttaagcttttggttagatacggt
-
Reverse:
ccctttcccatgtacttaacattt
-
Product
-
Name: F1-capsular antigen
-
Size: 243 bp
-
Pair of primers
-
Forward:
ccctttcccatgtacttaacattt
-
Reverse:
tgtgtggcgggcagtgtggtaccctc
-
Product
-
Name: 16s rRNA
-
Size: 412 bp
-
Multiplex PCR Assay:
-
Time to Perform:
1-hour-to-1-day
-
Description:
A PCR method for detection of Yersinia pestis-virulence determinants using four pairs of primers (multiplex) that anneal to both plasmid and chromosomal sequences (antigen fraction-1 gene (caf1), Yersinia pestis-specific region of the yopM gene, plasminogen activator gene (pla), and the inv gene) was developed in 1996. The results indicated that the yopM, pla, and caf1 primers were specific for the detection of the 40-Md, 7-Md, and 60-Md virulent plasmids of Yersinia pestis, respectively (Tsukano et al., 1996).
The Yersinia pestis inv gene is chromosomally located and has been shown to be inactivated by the presence of an insertion sequence (Simonet et al., 1996).
The inv gene is also found in Yersinia pseudotuberculosis, so it is not possible to differentiate between Yersinia pestis and Yersinia pseudotuberculosis based only on the presence of this PCR product (Tsukano et al., 1996).
-
Primers:
-
Pair of primers
-
Forward:
CAGGAACCACTAGCACATC
-
Reverse:
CCCCCACAAGGTTCTCAC
-
Product
-
Pair of primers
-
Forward:
TAAGGGTACTATCGCGGCGGA
-
Reverse:
CGTGAAATTAACCGTCACACT
-
Product
-
Pair of primers
-
Forward:
ATCTTACTTTCCGTGAGAAG
-
Reverse:
CTTGGATGTTGAGCTTCCTA
-
Product
-
Pair of primers
-
Forward:
ATAACTCATCGGGGGCAAAAT
-
Reverse:
GCGTTATTTATCCGAATTTAGC
-
Product
-
PCR amplification of plasmid sequences (plasminogen activator gene (pla) and antigen fraction 1 gene (caf1)):
-
Time to Perform:
1-hour-to-1-day
-
Description:
A PCR method for detection of Yersinia pestis using two pairs of primers that anneal to plasmid sequences (plasminogen activator gene (pla) and antigen fraction 1 gene (caf1)) was developed in 1994 (Norkina et al., 1994).
-
Primers:
-
caf1
-
Forward:
CAGTTCCGTTATCGCCATTGC
-
Reverse:
TATTGGTTAGATACGGTTACGGT
-
Product
-
pla
-
Forward:
TGGATGAATGAAAATCAATCTGAG
-
Reverse:
ATAATATCCAGCGTTAATTACGGT
-
Product
-
TaqMan Assay/Fluorogenic PCR (Iqbal et al., 2000):
-
Time to Perform:
1-hour-to-1-day
-
Description:
TaqMan Assay/Fluorogenic PCR. Yersinia pestis isolates known to contain the pesticin gene (located on plasmid pPCP) were detected using a fluorogenic probe-coupled PCR (TaqMan assay). The assay was reported to detect as few as three Yersinia pestis gene targets following 40 amplification cycles and be specific for pesticin-containing Yersinia (Iqbal et al., 2000).
-
Primers:
-
pesticin
-
Forward:
GAATGGTTCAGGTGGTGTTCC
-
Reverse:
TTCTCCATCTCCGTATCAATCG
-
Real-time-probe:
TGGATCTGCCTGGCCGGAGTAATT
-
TaqMan Assay/Fluorogenic PCR using microchip PCR array instruments (Belgrader et al., 1998, Belgrader et al., 1999, Belgrader et al., 2001):
-
Time to Perform:
minutes-to-1-hour
-
Description:
In 1998, scientists at Lawrence Livermore National Laboratory designed a novel instrument called the "Advanced Nucleic Acid Analyzer (ANAA), which could perform multiple, rapid fluorogenic TaqMan assays. The ANAA contains ten reaction modules in a "suitcase-sized" portable format. It can be used in the field, offers real-time monitoring, low power usage (for battery operation), no moving optical components, custom plastic sample tubes and caps, and softward tailored for first responders, such as emergency medical technicians (Belgrader et al., 1999).
The ANAA was used to detect several pathogens including Erwinia herbicola, which is a standard surrogate for Yersinia pestis (Belgrader et al., 1998, Belgrader et al., 1999).
The initial report demonstrated that samples with greater than or equal to 100 Erwinia cells per milliliter could be detected in approximately 18-26 minutes (Belgrader et al., 1998).
Subsequently, performance enhancing modifications were made to the ANAA that resulted in a 17-second thermal cycling time. The improved ANAA could detect 500 Erwinia cells in 7 minutes and 5 Erwinia cells in 9 minutes (Belgrader et al., 1999).
In 2001, scientists at Cepheid (including at least one person involved in the development of the ANAA) described a next generation, battery-powered, notebook-sized, fluorometric thermal cycler for rapid, multiplex, real-time PCR analysis. The instrument has two reaction modules and weighs 3.3 kilograms (including batteries). It is designed to discriminate between four different fluorescent dyes in a mixture, allowing for real-time monitoring of multiple fluorogenic probes, such as those specific for microbial, allelic, or internal positive control templates in the same PCR reaction. Additionally, the two modules can be operated together or independently (Belgrader et al., 2001).
-
Traditional Ribotyping (Guiyole et al., 1994):
-
Time to Perform:
2-to-7-days
-
Description:
The rRNA gene restriction fragment length polymorphisms of 70 strains of Yersinia pestis were determined by hybridization with a 16S-23S rRNA probe from Escherichia coli. The combination of EcoRI and EcoRV patterns resulted in the elucidation of 16 distinct ribotypes. The EcoRI rRNA gene restriction patterns of Yersinia pestis and Yersinia pseudotuberculosis differed greatly (Iqbal et al., 2000).
-
VNTR Analysis (Adair et al., 2000):
-
Time to Perform:
1-hour-to-1-day
-
Description:
A tetranucleotide repeat sequence, CAAA, was identified in the genome of Yersinia pestis that can be used for variable-number tandem repeat (VNTR) analysis. The repeat is in an intergenic region between two tentively identified open reading frames. The tetranucleotide repeat variation was characterized in 53 Yersinia DNAs, 35 of which were from unique Yersinia pestis strains. Nine alleles of the CAAA VNTR were represented within the 35 Yersinia pestis strains tested (Adair et al., 2000).
VNTR analysis has a greater discriminatory capacity than the ribotyping method, however, VNTR analysis examines a more limited region of the genome than pulsed-field gel electrophoresis. Locus-specific primer 1: GGTTAGGTAGGGTGTTGAAG Locus-specific primer 2: AAAGAGGCTAAGTGGCAA (Huang et al., 2002)
-
PFGE Analysis (Huang et al., 2002):
-
Time to Perform:
2-to-7-days
-
Description:
Pulsed-field gel electrophoresis (PFGE) analysis was used in 2002 to perform an epidemiological investigation of the genetic variability of well-documented strains of 37 Yersinia pestis from the United States. This technique demonstrated an increased ability to discriminate between strains and therefore can significantly improve epidemiological studies related to the origin of new plague isolates (Huang et al., 2002).
-
Nuclease Assay (Huang et al., 2002):
-
Time to Perform:
1-hour-to-1-day
-
Description:
Lindler and Fan have developed a 5' nuclease assay to detect ciprofloxacin resistance (Cip(r)) in Yersinia pestis. Two groups of fluorogenic probes were developed. The first group included a probe homologous to the wild type Y. pestis gyrA sequence with two corresponding probes that were homologous with two different mis-sense mutations in codon 81 of GyrA. The second group of probes included a wild type probe and two corresponding probes that recognized mis-sense mutations in codon 83 or gyrA. The 5' nuclease assay was sensitive to 1pg (approximately 1 colony forming unit) of starting template and could be used on semi-purified DNA. They isolated and characterized sixty one Cip(r) strains of Y. pestis KIM5. Cip(r) was found to be due to one of four point mutations in gyrA that altered codon 81 or 83. Although they did not use a crude lysates method in these experiments, their earlier results demonstrate that crude lysates are a suitable template for fluorogenic detection of Cip(r) Y. pestis after a short 2-hour growth period. Accordingly, they envision using the 5' nuclease assay to test bacterial colonies for Cip(r) from agar plates after the organism has been isolated. Using the short growth period for template preparation, this would allow a determination to be made within 3 h of isolation (Lindler and Fan, 2003).
-
Other Types of Diagnostic Tests:
No other tests available here.
V. References
A. Journal References:
Adair et al., 2000:
Adair D.M.,
Worsham P.L.,
Hill K.K., Klevytska AM, Jackson PJ, Friedlander AM, Keim P. Diversity in a variable-number tandem repeat from Yersinia pestis. .
Journal of Clinical Microbiology.
2000;
38:
1516 -
1519.
[PubMed:
10747136].
Belgrader et al., 1998:
Belgrader P.,
Benett W.,
Hadley D., Long G, Mariella R Jr, Milanovich F, Nasarabadi S, Nelson W, Richards J, Stratton P. Rapid pathogen detection using a microchip PCR array instrument. .
Clinical Chemistry.
1998;
44(10):
2191 -
2194.
[PubMed:
9761255].
Belgrader et al., 1999:
Belgrader P.,
Benett W.,
Hadley D., Richards J, Stratton P, Mariella R Jr, Milanovich F. PCR detection of bacteria in seven minutes. .
Science.
1999;
284(5413):
449 -
450.
[PubMed:
10232992].
Belgrader et al., 2001:
Belgrader P.,
Young S.,
Yuan B., Primeau M, Christel LA, Pourahmadi F, Northrup MA. A battery-powered notebook thermal cycler for rapid multiplex real-time PCR analysis. .
Analytical Chemistry.
2001;
73(2):
286 -
289.
[PubMed:
11199979].
Ber et al., 2003:
Ber R, Mamroud E, Aftalion M, Tidhar A, Gur D, Flashner Y, Cohen S. Development of an improved selective agar medium for isolation of Yersinia pestis. .
Applied Environmental Microbiology.
2003;
69(10):
5787 -
5792.
[PubMed:
14532026].
Bruneteau and Minkab, 2003:
Bruneteau M.,
Minkab S. Lipopolysaccharides of bacterial pathogens from the genus Yersinia: a mini-review. .
Biochimie.
2003;
85(1-2):
145 -
152.
[PubMed:
12765784].
Chanteau et al., 2000:
Chanteau S.,
Rahalison L.,
Ratsitorahina M., Mahafaly, Rasolomaharo M, Boisier P, O'Brien T, Aldrich J, Keleher A, Morgan C, Burans J. Early diagnosis of bubonic plague using F1 antigen capture ELISA assay and rapid immunogold dipstick. .
International Journal of Medical Microbiology.
2000;
290:
279 -
283.
[PubMed:
10959730].
Chanteau et al., 2003:
Chanteau S, Rahalison L, Ralafiarisoa L, Foulon J, Ratsitorahina M, Ratsifasoamanana L, Carniel E, Nato F. Development and testing of a rapid diagnostic test for bubonic and pneumonic plague. .
Lancet.
2003;
361(9353):
211 -
216.
[PubMed:
12547544].
Cornelis, 2002:
Cornelis G.R. Yersinia type III secretion: send in the effectors. .
The Journal of Cell Biology.
2002;
158:
401 -
408.
[PubMed:
12163464].
Deng et al., 2002:
Deng W.,
Burland V.,
Plunkett G., Boutin A, Mayhew GF, Liss P, Perna NT, Rose DJ, Mau B, Zhou S, Schwartz DC, Fetherston JD, Lindler LE, Brubaker RR, Plano GV, Straley SC, McDonough KA, Nilles ML, Matson JS, Blattner FR, Perry RD.
Genome sequence of Yersinia pestis KIM. .
Journal of Bacteriology.
2002;
184:
4601 -
4611.
[PubMed:
12142430].
Diatlov, 2003:
Diatlov AI. Prospects of plaque control in its natural foci. .
Zh Mikrobiol Epidemiol Immunobiol..
2001;
6 Suppl():
64 -
66.
[PubMed:
12718179].
Dong et al., 2000:
Dong X. Q.,
Lindler L. E.,
Chu M. C. Complete DNA sequence and analysis of an emerging cryptic plasmid isolated from Yersinia pestis. .
Plasmid.
2000;
43:
144 -
148.
[PubMed:
10686133].
Du et al., 2002:
Du Y.,
Rosqvist R.,
Forsberg A. Role of fraction 1 antigen of Yersinia pestis in inhibition of phagocytosis. .
Infection and Immunity.
2002;
70:
1453 -
1460.
[PubMed:
11854232].
Eyles et al., 1998:
Eyles JE,
Sharp GJ,
Williamson ED, Spiers ID, Alpar HO. Intra nasal administration of poly-lactic acid microsphere co-encapsulated Yersinia pestis subunits confers protection from pneumonic plague in the mouse. .
Vaccine.
1998;
16(7):
698 -
707.
[PubMed:
9562689].
Frean et al., 2003:
Frean J., Klugman KP, Arntzen1 L, Bukofzer S. Susceptibility of Yersinia pestis to novel and conventional antimicrobial agents. .
Journal of Antimicrobial Chemotherapy.
2003;
52():
294 -
296.
[PubMed:
12865386].
Garmory et al., 2003:
Garmory HS., Griffin KF, Brown KA, Titball RW. Oral immunisation with live aroA attenuated Salmonella enterica serovar Typhimurium expressing the Yersinia pestis V antigen protects mice against plague. .
Vaccine.
2003;
21(21-22):
3051 -
3057.
[PubMed:
12798649].
Green et al., 1999:
Green M.,
Rogers D.,
Russell P., Stagg AJ, Bell DL, Eley SM, Titball RW, Williamson ED. The SCID/Beige mouse as a model to investigate protection against Yersinia pestis. .
FEMS Immunol Med Microbiol..
1999;
23(2):
107 -
113.
[PubMed:
10076907].
Grosfeld et al., 2003:
Grosfeld H, Cohen S, Bino T, Flashner Y, Ber R, Mamroud E, Kronman C, Shafferman A, Velan B. Effective Protective Immunity to Yersinia pestis Infection Conferred by DNA Vaccine Coding for Derivatives of the F1 Capsular Antigen. .
Infection and Immunity.
2003;
71(1):
374 -
383.
[PubMed:
12496187].
Guiyole et al., 1994:
Guiyoule A.,
Grimont F.,
Iteman I., Grimont PA, Lefevre M, Carniel E. Plague pandemics investigated by ribotyping of Yersinia pestis strains. .
Journal of Clinical Microbiology.
1994;
32:
634 -
641.
[PubMed:
8195371].
Huang et al., 2002:
Huang X.Z.,
Chu M.C.,
Engelthaler D.M., Lindler L.E. Genotyping of a homogeneous group of Yersinia pestis strains isolated in the United States. .
Journal of Clinical Microbiology.
2002;
40:
1164 -
1173.
[PubMed:
11923326].
Inglesby et al., 2000:
Inglesby T.V.,
Dennis D.T.,
Henderson D.A., Bartlett JG, Ascher MS, Eitzen E, Fine AD, Friedlander AM, Hauer J, Koerner JF, Layton M, McDade J, Osterholm MT, O'Toole T, Parker G, Perl TM, Russell PK, Schoch-Spana M, Tonat K. Plague as a biological weapon: medical and public health management. Working Group on Civilian Biodefense. .
Journal of the American Medical Association.
2000;
283(17):
2281 -
2290.
[PubMed:
10807389].
Iqbal et al., 2000:
Iqbal S.S.,
Chambers J.P.,
Goode M.T.,
Valdes J.J.,
Brubaker R.R. Detection of Yersinia pestis by pesticin fluorogenic probe-coupled PCR. .
Molecular and Cellular Probes.
2000;
14:
109 -
114.
[PubMed:
10799272].
Jones et al., 2003:
Jones SM., Griffin KF, Hodgson I, Williamson ED. Protective efficacy of a fully recombinant plague vaccine in the guinea pig. .
Vaccine.
2003;
21(25-25):
3912 -
3918.
[PubMed:
12922126].
Liang et al., 2003:
Liang F., Huang Z, Lee SY, Liang J, Ivanov MI, Alonso A, Bliska JB, Lawrence DS, Mustelin T, Zhang ZY. Aurintricarboxylic acid blocks in vitro and in vivo activity of YopH, an essential virulent factor of Yersinia pestis, the agent of plague. .
Journal of Biological Chemistry.
2003;
Epub ahead of print(July 2003):
Epub ahead of print -
Epub ahead of print.
[PubMed:
12888560].
Lindler and Fan, 2003:
Lindler LE., Fan W. Development of a 5' nuclease assay to detect ciprofloxacin resistant isolates of the biowarfare agent Yersinia pestis. .
Molecular and Cellular Probes.
2003;
17(1):
41 -
47.
[PubMed:
12628593].
Loiez et al., 2003:
Loiez C, Herwegh S, Wallet F, Armand S, Guinet F, Courcol RJ. Detection of Yersinia pestis in sputum by real-time PCR. .
Journal of Clinical Microbiology.
2003;
41(10):
4873 -
4875.
[PubMed:
14532247].
Neubauer et al., 2000:
Neubauer H.,
Meyer H.,
Prior J., Aleksic S, Hensel A, Splettstosser W. A combination of different polymerase chain reaction (PCR) assays for the presumptive identification of Yersinia pestis. .
Journal of Veterinary Medicine. B, Infectious diseases and veterinary public health.
2000;
47:
573 -
580.
[PubMed:
11075545].
Norkina et al., 1994:
Norkina O.V.,
Kulichenko A.N.,
Gintsburg A.L., Tuchkov IV, Popov YuA, Aksenov MU, Drosdov IG. Development of a diagnostic test for Yersinia pestis by the polymerase chain reaction. .
Journal of Applied Biotechnology.
1994;
76:
240 -
245.
[PubMed:
8157543].
Osorio et al., 2003:
Osorio JE., Powell TD, Frank RS, Moss K, Haanes EJ, Smith SR, Rocke TE, Stinchcomb DT. Recombinant raccoon pox vaccine protects mice against lethal plague. .
Vaccine.
2003;
21(11-12):
1232 -
1238.
[PubMed:
12559803].
Parkhill et al., 2001:
Parkhill J.,
Wren B. W.,
Thomson N. R., Titball RW, Holden MT, Prentice MB, Sebaihia M, James KD, Churcher C, Mungall KL, Baker S, Basham D, Bentley SD, Brooks K, Cerdeno-Tarraga AM, Chillingworth T, Cronin A, Davies RM, Davis P, Dougan G, Feltwell T, Hamlin N, Holroyd S, Jagels K, Karlyshev AV, Leather S, Moule S, Oyston PC, Quail M, Rutherford K, Simmonds M, Skelton J, Stevens K, Whitehead S, Barrell BG. Genome sequence of Yersinia pestis, the causative agent of plague. .
Nature.
2001;
413(4 October):
523 -
527.
[PubMed:
11586360].
Perry and Fetherston, 1997:
Perry R. D.,
Fetherston J. D. Yersinia pestis-etiologic agent of plague. .
Clinical Microbiology Reviews.
1997;
10:
35 -
66.
[PubMed:
8993858].
Radnedge et al., 2001:
Radnedge L.,
Gamez-Chin S.,
McCready P.M.,
Worsham P.L.,
Andersen G.L. Identification of nucleotide sequences for the specific and rapid detection of Yersinia pestis. .
Applied and Environmental Microbiology.
2001;
67:
3759 -
3762.
[PubMed:
11472963].
Rider et al., 2003:
Rider TH., Petrovick MS, Nargi FE, Harper JD, Schwoebel ED, Mathews RH, Blanchard DJ, Bortolin LT, Young AM, Chen J, Hollis MA. A B cell-based sensor for rapid identification of pathogens. .
Science.
2003;
301(5630):
213 -
215.
[PubMed:
12855808].
Rose et al., 2003:
Rose LJ., Donlan R, Banerjee SN, Arduino MJ. Survival of Yersinia pestis on environmental surfaces. .
Applied and Environmental Microbiology.
2003;
69(4):
2166 -
2171.
[PubMed:
12676697].
Simonet et al., 1996:
Simonet S.,
Riot B.,
Fortineau N., Berche P. Invasin production by Yersinia pestis is abolished by insertion of an IS200-like element within the inv gene. .
Infection and Immunity.
1996;
64:
375 -
379.
[PubMed:
8557370].
Splettstoesser et al., 2003:
Splettstoesser WD., Grunow R, Rahalison L, Brooks TJ, Chanteau S, Neubauer H. Serodiagnosis of human plague by a combination of immunomagnetic separation and flow cytometry. .
Cytometry.
2003;
53A(2):
88 -
96.
[PubMed:
12766970].
Tsukano et al., 1996:
Tsukano H.,
Itoh K.,
Suzuki S.,
Watanabe H. Detection and identification of Yersinia pestis by polymerase chain reaction (PCR) using multiplex primers. .
Microbiology and Immunology.
1996;
40:
773 -
775.
[PubMed:
8981352].
Williams et al., 2000:
Williams K,
Oyston PC,
Dorrell N, Li S, Titball RW, Wren BW. Investigation into the role of the serine protease HtrA in Yersinia pestis pathogenesis. .
FEMS Microbiol Lett.
2000;
186(2):
281 -
286.
[PubMed:
10802185].
Williamson et al., 2000:
Williamson ED,
Eley SM,
Stagg AJ, Green M, Russell P, Titball RW. A single dose sub-unit vaccine protects against pneumonic plague. .
Vaccine.
2000;
19(4-5):
566 -
571.
[PubMed:
11027822].
Williamson et al., 2001:
Williamson E.D.,
Eley S.M.,
Stagg A.J., Green M, Russell P, Titball RW. A single dose sub-unit vaccine protects against pneumonic plague. .
Vaccine.
2001;
19:
566 -
571.
[PubMed:
11027822].
B. Book References:
Anderson et al., 2002:
Mercier R-C. Tetracyclines. .
166 -
172.
In: Anderson PO,
Knoben JE,
Troutman WG. Handbook of Clinical Drug Data 10th Edition2002.
McGraw Hill,
New York, Chicago, San Francisco, Lisbon, London, Madrid, Mexico City, Milan, New Delhi, San Juan, Seoul, Singapore, Sydney, Toronto.
Butler, 2000:
Butler Thomos. Yersinia Species, Including Plague. .
2406 -
2414.
In: Mandell Gerald,
Bennett John,
Dolin Raphael. Principles and Practice of Infectious Diseases, 5th edition.
Churchill Livingstone,
New York.
Quan, 1987:
Quan T.J. Plague. .
445 -
453.
In: Wentworth B.B. Diagnostic Procedures For Bacterial Infections, 7th edition1987.
American Public Health Association, Inc.,
Washington, D.C..
C. Website References:
Website 1:
Plague. [
http://www.emedicine.com/ped/topic1819.htm
].
Website 2:
Plaque. [
http://www.emedicine.com/med/topic3381.htm
].
Website 3:
Yersinia pestis plasmid pCD1, complete sequence. [
http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?gi=15797&db=Genome
].
Website 4:
Pharyngitis. [
http://www.emedicine.com/ped/topic1785.htm
].
Website 5:
Bronchitis. [
http://www.emedicine.com/emerg/topic69.htm
].
Website 6:
Level A Laboratory Procedures for Identification of Yersinia pestis. [
http://www.bt.cdc.gov/Agent/Plague/ype_la_cp_121301.pdf
].
Website 7:
Image: Yersinia pestis. [
http://www.cdc.gov/ncidod/dvbid/plague/ifa.htm
].
Website 8:
Image: Wayson stain of Yersinia pestis. [
http://www.cdc.gov/ncidod/dvbid/plague/wayson.htm
].
Website 9:
Laboratory Test Criteria for Diagnosis of Plague. [
http://www.cdc.gov/ncidod/dvbid/plague/lab-test-criteria.htm
].
Website 10:
Epidemiology. [
http://www.cdc.gov/ncidod/dvbid/plague/epi.htm
].
Website 11:
Plague (Yersinia pestis). [
http://www.peteducation.com/article.cfm?cls=2&cat=1554&articleid=337
].
Website 12:
Yersinia. [
http://www.cehs.siu.edu/fix/medmicro/yersi.htm
].
Website 13:
Image: Yersinia pestis bacteria shown in fluorescent antibody test. [
http://www.cdc.gov/ncidod/dvbid/plague/p4.htm
].
Website 14:
Yersinia pestis strain CO92, complete genome. [
http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?gi=201&db=Genome&gi=201
].
Website 15:
BACTERIAL AGENTS. [
http://www.cdc.gov/od/ohs/biosfty/bmbl/sect7c.htm#Yers
].
Website 16:
Yersinia pestis as a Bioterrorist Agent. [
http://www.tdh.texas.gov/bioterrorism/facts/plague.html
].
Website 17:
CBRNE - Plague [
http://www.emedicine.com/emerg/topic428.htm
].
Website 18:
Interim Guidelines for Action in the Event of a Delibrate Release: Plaque. [
http://www.hpa.org.uk/infections/topics_az/deliberate_release/Plague/PDFs/plague_guidelines.pdf
].
Website 19:
Yersinia pestis plasmid pMT1, complete sequence. [
http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?gi=15799&db=Genome
].
Website 20:
BASIC LABORATORY PROTOCOLS FOR THE PRESUMPTIVE IDENTIFICATION OF Yersinia pestis. [
http://www.health.state.nd.us/healthalert/PlagueLabProtocols.pdf
].
Website 21:
Yersinia pestis - the Black Death. [
http://plagueyersiniapestis.homestead.com/YERSINIAPESTIS.HTML
].
Website 22:
Taxonomy browser (Yersinia pestis). [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=632&lvl=3&keep=1&srchmode=5&unlock
].
Website 23:
Taxonomy browser (Yersinia pestis KIM). [
http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=187410
].
Website 24:
Yersinia pestis KIM, complete genome. [
http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=Genome&gi=250
].
Website 25:
Vaccine development for plague. Medscape Infectious Diseases 4(2), 2002. [
http://www.medscape.com/viewarticle/441260
].
Website 26:
Yersinia pestis plasmid pYC, complete sequence. [
http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=genome&gi=15248
].
Website 27:
Plague: essential data. [
http://www.cbwinfo.com/Biological/Pathogens/YP.html
].
Website 28:
Yersinia pestis plasmid pPCP1, complete sequence. [
http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=genome&gi=15798
].
Website 29:
Yersinia pestis KIM plasmid pMT1, complete sequence. [
http://www.ncbi.nlm.nih.gov/genomes/framik.cgi?db=Genome&gi=17113
].
Website 30:
Yersinia pestis KIM plasmid pCD1, complete sequence. [
http://www.ncbi.nlm.nih.gov/genomes/paltik.cgi?gi=17114&db=Genome
].
Website 31:
Yersinia pestis KIM plasmid pPCP1, complete sequence. [
http://www.ncbi.nlm.nih.gov/genomes/paltik.cgi?gi=17115&db=Genome
].
Website 32:
Yersinia pestis KIM plasmid pMT-1, complete sequence. [
http://www.ncbi.nlm.nih.gov/genomes/paltik.cgi?gi=17116&db=Genome
].
Website 33:
Yersinia pestis KIM plasmid pCD1, complete sequence. [
http://www.ncbi.nlm.nih.gov/genomes/paltik.cgi?gi=17117&db=Genome
].
Website 34:
.Yersinia pestis KIM complete sequence. [
http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=NC_004088
].
D. Thesis References:
No thesis or dissertation references used.
VI. Curation Information
-
Curators:
Randy Vines (rvines@vbi.vt.edu); Yongqun (Oliver) He; Daryl Stang
-
Date: 5/16/2004
-
Version: 1.5
-
Contact information:
- Email: pathinfo@vbi.vt.edu